ID: 1051029479

View in Genome Browser
Species Human (GRCh38)
Location 9:12657693-12657715
Sequence AGATCTCCATGAAGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051029465_1051029479 16 Left 1051029465 9:12657654-12657676 CCTTGCCCCAGAACTTCCTTCCA No data
Right 1051029479 9:12657693-12657715 AGATCTCCATGAAGGGAAACTGG No data
1051029463_1051029479 28 Left 1051029463 9:12657642-12657664 CCAGATACACTCCCTTGCCCCAG No data
Right 1051029479 9:12657693-12657715 AGATCTCCATGAAGGGAAACTGG No data
1051029468_1051029479 9 Left 1051029468 9:12657661-12657683 CCAGAACTTCCTTCCAACCCCAC No data
Right 1051029479 9:12657693-12657715 AGATCTCCATGAAGGGAAACTGG No data
1051029466_1051029479 11 Left 1051029466 9:12657659-12657681 CCCCAGAACTTCCTTCCAACCCC No data
Right 1051029479 9:12657693-12657715 AGATCTCCATGAAGGGAAACTGG No data
1051029464_1051029479 17 Left 1051029464 9:12657653-12657675 CCCTTGCCCCAGAACTTCCTTCC No data
Right 1051029479 9:12657693-12657715 AGATCTCCATGAAGGGAAACTGG No data
1051029473_1051029479 -9 Left 1051029473 9:12657679-12657701 CCCACCCAATGGCTAGATCTCCA No data
Right 1051029479 9:12657693-12657715 AGATCTCCATGAAGGGAAACTGG No data
1051029472_1051029479 -8 Left 1051029472 9:12657678-12657700 CCCCACCCAATGGCTAGATCTCC No data
Right 1051029479 9:12657693-12657715 AGATCTCCATGAAGGGAAACTGG No data
1051029470_1051029479 0 Left 1051029470 9:12657670-12657692 CCTTCCAACCCCACCCAATGGCT No data
Right 1051029479 9:12657693-12657715 AGATCTCCATGAAGGGAAACTGG No data
1051029474_1051029479 -10 Left 1051029474 9:12657680-12657702 CCACCCAATGGCTAGATCTCCAT No data
Right 1051029479 9:12657693-12657715 AGATCTCCATGAAGGGAAACTGG No data
1051029467_1051029479 10 Left 1051029467 9:12657660-12657682 CCCAGAACTTCCTTCCAACCCCA No data
Right 1051029479 9:12657693-12657715 AGATCTCCATGAAGGGAAACTGG No data
1051029471_1051029479 -4 Left 1051029471 9:12657674-12657696 CCAACCCCACCCAATGGCTAGAT No data
Right 1051029479 9:12657693-12657715 AGATCTCCATGAAGGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051029479 Original CRISPR AGATCTCCATGAAGGGAAAC TGG Intergenic
No off target data available for this crispr