ID: 1051029481

View in Genome Browser
Species Human (GRCh38)
Location 9:12657699-12657721
Sequence TCCAATCCAGTTTCCCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 6, 1: 6, 2: 7, 3: 36, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051029481_1051029485 12 Left 1051029481 9:12657699-12657721 CCATGAAGGGAAACTGGATTGGA 0: 6
1: 6
2: 7
3: 36
4: 182
Right 1051029485 9:12657734-12657756 TTCCCAACACCCAGGGTTGATGG No data
1051029481_1051029486 13 Left 1051029481 9:12657699-12657721 CCATGAAGGGAAACTGGATTGGA 0: 6
1: 6
2: 7
3: 36
4: 182
Right 1051029486 9:12657735-12657757 TCCCAACACCCAGGGTTGATGGG No data
1051029481_1051029483 4 Left 1051029481 9:12657699-12657721 CCATGAAGGGAAACTGGATTGGA 0: 6
1: 6
2: 7
3: 36
4: 182
Right 1051029483 9:12657726-12657748 AGGCAACATTCCCAACACCCAGG No data
1051029481_1051029490 15 Left 1051029481 9:12657699-12657721 CCATGAAGGGAAACTGGATTGGA 0: 6
1: 6
2: 7
3: 36
4: 182
Right 1051029490 9:12657737-12657759 CCAACACCCAGGGTTGATGGGGG No data
1051029481_1051029488 14 Left 1051029481 9:12657699-12657721 CCATGAAGGGAAACTGGATTGGA 0: 6
1: 6
2: 7
3: 36
4: 182
Right 1051029488 9:12657736-12657758 CCCAACACCCAGGGTTGATGGGG No data
1051029481_1051029484 5 Left 1051029481 9:12657699-12657721 CCATGAAGGGAAACTGGATTGGA 0: 6
1: 6
2: 7
3: 36
4: 182
Right 1051029484 9:12657727-12657749 GGCAACATTCCCAACACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051029481 Original CRISPR TCCAATCCAGTTTCCCTTCA TGG (reversed) Intergenic
900280091 1:1861521-1861543 GCCAATCCTGCTTCCCTTGAGGG - Intronic
900795520 1:4705960-4705982 TCATCTCCAGTTTCCCCTCAAGG - Intronic
901685635 1:10941979-10942001 TCCAACCCCTTGTCCCTTCATGG - Intergenic
905257382 1:36693535-36693557 TCCTCTCCACTTCCCCTTCACGG - Intergenic
909423601 1:75494832-75494854 TCCAATTCCTTTTCTCTTCATGG - Intronic
909684208 1:78328438-78328460 ACCAACCCTGTTTCCCATCATGG - Intronic
911853145 1:102843392-102843414 TGAAGTCCTGTTTCCCTTCATGG - Intergenic
914919167 1:151836141-151836163 TCAAATCCAGTTTCTCACCAAGG + Intergenic
915536544 1:156539613-156539635 TCCATTCCAGATTTCCATCAGGG - Intronic
915537385 1:156545224-156545246 TCCAATCCAGTCTCCTTCCTAGG + Intronic
916116286 1:161487624-161487646 TTTAAACCAGTTTCCTTTCATGG - Intergenic
916532816 1:165674360-165674382 CCCTATCCTGTTTTCCTTCATGG - Intronic
917967963 1:180190446-180190468 GCCAATCCAGTTCACCTTCTTGG - Exonic
918822331 1:189270754-189270776 TCCAGTCCAGTTTCTCTTTATGG - Intergenic
920568008 1:206991462-206991484 TCCAATCCAGTTGGTCTCCAGGG - Intergenic
922217555 1:223532677-223532699 CCCAATCCAGCTTCCATTGAAGG + Intergenic
923934492 1:238746252-238746274 TTCAATCCAGCTTCCCTTCACGG + Intergenic
923955785 1:239018723-239018745 TCCAATACATTCTCCTTTCATGG + Intergenic
1063186295 10:3654739-3654761 TCCAAACCAGCTTCCCATCTTGG - Intergenic
1063331553 10:5164708-5164730 TCCACTCCAGTTTTCTTTCATGG + Intergenic
1065330688 10:24595241-24595263 TGTAATCTAGTTTCCCTTTAAGG + Intronic
1068195955 10:53716479-53716501 TACAATCCAGTTTCCTTATAGGG - Intergenic
1068462441 10:57344910-57344932 TTCAAACCAGTTTCCTTTCATGG - Intergenic
1071426099 10:85554193-85554215 GCTTATCCAGTTTCTCTTCATGG - Intergenic
1073418394 10:103403957-103403979 CCCAATCCAGGTCCCCTTCAGGG - Intronic
1073715333 10:106100070-106100092 TCAATTCTATTTTCCCTTCAAGG - Intergenic
1076091607 10:127691396-127691418 TCAATTCCACTTTCCCTTAAAGG - Intergenic
1076885423 10:133260015-133260037 TCCCATCCAGCATCCCTTAAGGG + Intergenic
1077012926 11:387071-387093 TCCAACCCAGTTTTCCTTCATGG + Intergenic
1077491807 11:2864429-2864451 TCCCATCCACCTTCCCCTCAGGG + Intergenic
1077609278 11:3634516-3634538 TCCATTCCTTTTTCCCTTCTTGG - Intergenic
1078200793 11:9180937-9180959 TGCAATGAAGATTCCCTTCAGGG + Exonic
1080071174 11:28089116-28089138 TCGAATTCAGCTTCCCTTGAGGG - Intronic
1082121610 11:48385290-48385312 TTCAAAACAGTTTCCCTTCCTGG - Intergenic
1082252244 11:49995329-49995351 TTCAAACCAGTTTCCCTTCCTGG + Intergenic
1082555590 11:54559544-54559566 TTCAAACCAGTTTCCCTTCCTGG - Intergenic
1083587245 11:63869268-63869290 GCCAACTCAGTTTCTCTTCATGG + Intronic
1084160899 11:67349582-67349604 TCAAATCCAGTTTCTTATCATGG + Intronic
1085220506 11:74870237-74870259 TTCAAACCAGTTTCCTTTCATGG + Intronic
1085818208 11:79763930-79763952 TGCAATCCAGTCTCCCTGTATGG - Intergenic
1085951576 11:81338842-81338864 TCCAATCCAGCTACCAGTCATGG - Intergenic
1088314054 11:108489268-108489290 TCCATTCCACCTTACCTTCAAGG - Intronic
1089359361 11:117875975-117875997 TCCAATCCTGTTTCCTTTCCGGG - Intronic
1091173270 11:133537390-133537412 TACGTTCCAGTTTCCCTGCAAGG + Intergenic
1091219949 11:133924714-133924736 TCCAATCCAGCTTCTCCTCGTGG + Intronic
1092447003 12:8567263-8567285 TCTAACCCAATTTCCCTTCATGG - Intergenic
1092910949 12:13144541-13144563 ATGAATCCAGTTTCCTTTCAGGG + Intergenic
1093100304 12:15020305-15020327 TCCATTTAACTTTCCCTTCAAGG - Intergenic
1095602408 12:44028839-44028861 TCCAATCCAGACTCCATTCTTGG - Intronic
1095616691 12:44198697-44198719 TCCAAACCAGGTTCCTTTCTTGG - Intronic
1096986287 12:55760499-55760521 TTCACTCTAATTTCCCTTCAAGG + Intronic
1097130668 12:56808790-56808812 TCCAACCCGGTTTCCTTTCATGG - Intergenic
1098103148 12:67040521-67040543 TCCACTCAGGTGTCCCTTCATGG + Intergenic
1098865784 12:75761840-75761862 TAAAATACTGTTTCCCTTCAGGG + Intergenic
1102795734 12:115687483-115687505 TCAAATCCATTTTCCCTCCTTGG + Intergenic
1104089631 12:125504787-125504809 TGCAATTCAGCTTCCCTGCATGG - Intronic
1104412437 12:128570504-128570526 TGCAATCTAGTTTCTGTTCATGG - Intronic
1106620377 13:31366080-31366102 TCCAACCCAATTTCCCTTCCTGG + Intergenic
1107936568 13:45350399-45350421 TCTATTCCACTTTTCCTTCAGGG - Intergenic
1108267840 13:48730235-48730257 TCCTACCCTGTTCCCCTTCAAGG - Intergenic
1108681414 13:52783753-52783775 TGGAATCCAGTATCACTTCATGG - Intergenic
1108848137 13:54699554-54699576 TCCAATCCAGTTTCCCTTCATGG - Intergenic
1112083738 13:96005697-96005719 TCCAATTAAGTTTCCTTTCTAGG - Intronic
1112125126 13:96457572-96457594 TCCAATCCAATTTTTTTTCATGG - Intronic
1113945558 13:114042231-114042253 TCCCATCCTGCGTCCCTTCATGG + Intronic
1116288389 14:43002403-43002425 TCCAATCCAATTTTCTTTCATGG + Intergenic
1117012459 14:51484751-51484773 TCCACTTCACTTTCCCTCCATGG - Intergenic
1118964647 14:70568351-70568373 TTCAATCCTTTTTCCCTTTAGGG - Intergenic
1119445931 14:74663379-74663401 TCCACACCAGTTTCCCAACAGGG + Exonic
1121728298 14:96168817-96168839 TCCAAACCTGTTACCCTTCCAGG + Intergenic
1121884042 14:97526528-97526550 TCCAATCACTTTTGCCTTCAAGG - Intergenic
1123142591 14:106095228-106095250 TCCCCTCCTGTTTCCCTGCAGGG + Intergenic
1125526686 15:40380768-40380790 TCCAATCCAGGCTCTCTTCTGGG + Intergenic
1125631965 15:41154535-41154557 GTCATTCCAGTTTCCTTTCAGGG + Intergenic
1126091671 15:45058307-45058329 TCCAATCCAGTTTCCATTCATGG - Intronic
1126571058 15:50151144-50151166 TCCAATCCAACTTTCTTTCATGG - Intronic
1126796692 15:52265432-52265454 TCCATTCCAGTGTCCATTCCAGG - Intronic
1127269518 15:57388013-57388035 TCCAGTCCAGTCTCTCTCCAAGG - Intronic
1128308689 15:66617000-66617022 TCCAATCCATTTCCCTTTCTGGG - Intronic
1129377507 15:75143358-75143380 TCCAATCTAGTTTCCCTTCATGG - Intergenic
1132005363 15:98221651-98221673 TGCAATCCAGTTTCCCTGGAAGG - Intergenic
1133061509 16:3177805-3177827 TGCCCTCCAGTTTCCCTGCAGGG - Intergenic
1133089697 16:3394563-3394585 TCCAATCCATTCTCTCTACATGG + Intronic
1133837272 16:9378260-9378282 TCCTTCCCAGCTTCCCTTCAAGG - Intergenic
1135207188 16:20493315-20493337 TCCAATCCAGTTTCCCTTCATGG + Intergenic
1135211697 16:20530317-20530339 TCCAATCCAGTTTCCCTTCATGG - Intergenic
1135764867 16:25168908-25168930 TCCTGCCCAGTTTCCCTTCCAGG + Intronic
1138998488 16:62479844-62479866 TCCAATCCAGTTTCCTTTCATGG - Intergenic
1139277936 16:65745106-65745128 TCCCATGAACTTTCCCTTCAAGG - Intergenic
1142628674 17:1209084-1209106 GCCAATAAAGTTTGCCTTCATGG + Intronic
1142640366 17:1281742-1281764 CCAAATCCAGTTTCCCCTCCTGG - Intronic
1144143608 17:12375574-12375596 TCTAATTCACTTTCCCTTAAGGG - Intergenic
1144182433 17:12764682-12764704 CCCACTCCACTTTTCCTTCAAGG + Exonic
1144585497 17:16485192-16485214 TCCATTCCAGTTTCTCTTAATGG + Intronic
1145188370 17:20816377-20816399 CACAATTCAGTTTCCCTGCAAGG + Intergenic
1146474722 17:33153678-33153700 TCTCATCCCATTTCCCTTCAAGG + Intronic
1148921056 17:51034597-51034619 TCCAGTCCAGTTTGAATTCAAGG - Intronic
1151376005 17:73689554-73689576 TCCAATCCAGCCTCCACTCAGGG - Intergenic
1155318199 18:24593114-24593136 TCAAATCTTGGTTCCCTTCAGGG + Intergenic
1158595679 18:58813921-58813943 TCCACTCCATCTTCCCTTCTTGG - Intergenic
1159149673 18:64505155-64505177 GCCATTCCAGCTTCCCCTCATGG + Intergenic
1161395199 19:4041732-4041754 TACCATACAATTTCCCTTCAAGG - Intergenic
1164889614 19:31812224-31812246 TCCAATCCCACTTCCCTTTATGG + Intergenic
1166409597 19:42547724-42547746 GCCAATCCAGTGTCCCTTCTGGG - Intronic
1166438986 19:42794002-42794024 TTCAAACTAGTTTCCTTTCATGG - Intronic
1166473987 19:43104780-43104802 TTCAAACTAGTTTCCTTTCATGG - Intronic
924963990 2:58734-58756 TCCAACCTGGTTTCCCTTCACGG + Intergenic
925759598 2:7171657-7171679 TCCGTTCCATTTTCCCTCCAAGG + Intergenic
926005754 2:9372372-9372394 CAGAATCCAGTTTCCCTTTATGG + Intronic
926031172 2:9590269-9590291 TCCAATTCTGCTTACCTTCATGG + Intronic
927315355 2:21675176-21675198 TCGATTCCAGTCTCTCTTCATGG - Intergenic
927505961 2:23615087-23615109 TCCTATCCAGTTGCCCTTTCAGG + Intronic
929009416 2:37426167-37426189 TCAATTCAAGTTTCCCTTCAGGG + Intergenic
929317926 2:40502975-40502997 TCCAGACCATTTTCCCCTCAAGG - Intronic
930240903 2:48934771-48934793 CCCCATCCACTTTCCTTTCATGG - Intergenic
930280410 2:49362541-49362563 TCCAATCCAGAGTCCCTACTGGG - Intergenic
935954634 2:108363389-108363411 CCCATTCCAGTTTTACTTCATGG - Intergenic
941435274 2:165462695-165462717 TCCGATCAATTTTCCATTCAAGG + Intergenic
943180052 2:184529881-184529903 TCCAATACATTTTCCTTTCATGG - Intergenic
943441756 2:187934502-187934524 TCCAATCCAGTTTCCATTCACGG - Intergenic
947962470 2:234251232-234251254 TCAACTCCAATTTCACTTCAGGG + Intergenic
1173004434 20:39128871-39128893 TCCAATCCACTCTACCATCAGGG + Intergenic
1174562205 20:51439375-51439397 TCCAATCCGGCTTCCCCACAGGG - Intronic
1174566718 20:51469983-51470005 TCAACTCCACTTTCCCTGCAGGG - Intronic
1175568263 20:59998198-59998220 ACCATTTCTGTTTCCCTTCATGG - Intronic
1180864122 22:19106046-19106068 TCCAAGCCAGTCTCCCTGCGTGG - Intronic
1184846757 22:47092464-47092486 TCCACTCCAGTTTCCACTCCTGG - Intronic
950602334 3:14045775-14045797 TCCAACACTCTTTCCCTTCAGGG - Intronic
951833167 3:26952487-26952509 TCCAACCCCATTTCCCATCATGG + Intergenic
953368197 3:42365123-42365145 TCCAAACCAGTTTCAAATCAAGG - Intergenic
953880677 3:46689835-46689857 TTCCATCAAGTCTCCCTTCAGGG + Intronic
954767320 3:52930216-52930238 TCCAACCCATTTTTCCTTCTAGG - Intronic
954807638 3:53229702-53229724 TCCAAACCAGCTGCCCTTCAAGG + Intronic
956492386 3:69786955-69786977 TCCAATCCACTCTGCCTTCATGG + Intronic
957638609 3:82819120-82819142 TATATTCCAGTTTCCTTTCATGG - Intergenic
957701827 3:83725446-83725468 TCCAATCTACTTTATCTTCATGG + Intergenic
957702058 3:83727257-83727279 TCCAATCTAGTTTATCTTCATGG - Intergenic
957910756 3:86618146-86618168 TTCAAAACAGTTTCCTTTCACGG + Intergenic
958019477 3:87979302-87979324 TCCAATCCAGTTTCCCTTCATGG - Intergenic
961111223 3:124284949-124284971 TGCAAGGCTGTTTCCCTTCATGG + Intronic
961786812 3:129352468-129352490 GCCAATCCACTTTTCCTTTAGGG - Intergenic
963173957 3:142279669-142279691 TTCAAACCAGTTTCCTTTCATGG + Intergenic
963523412 3:146385192-146385214 TCCAATCCAACTTTCTTTCATGG + Intergenic
963643243 3:147883040-147883062 TCCAATCAAGTTTCCTTTTATGG - Intergenic
963661814 3:148135977-148135999 TCCATTCCAGTTTCCCTAGTTGG + Intergenic
964927642 3:161977560-161977582 TCCAATTCAGTTTTCCTTCATGG - Intergenic
965008705 3:163058054-163058076 TTCAATCTTGTTTCCTTTCATGG - Intergenic
966770822 3:183501749-183501771 CCCAATCCACTTACCCTTTAAGG + Intronic
968362289 3:198155756-198155778 TCCAACCCAGATGCGCTTCATGG - Intergenic
968700713 4:2056706-2056728 TCCAAACCAGCTCCCCTTAAAGG + Intergenic
972284783 4:37637653-37637675 TCCAATCCTGTGTTCCTCCATGG + Intronic
974617280 4:64306287-64306309 TCCAAAACAGTTTCCCTTCATGG + Intronic
975008655 4:69321967-69321989 TCCAAACCAGTTTCCCTTCATGG + Intronic
975884419 4:78947354-78947376 TAAAATCCAGCATCCCTTCATGG - Intergenic
976922488 4:90456586-90456608 TCCAATCCAGTTTCCCTTCATGG - Intronic
978491157 4:109313654-109313676 TCCAATCCAGTTTCCTTTCCTGG + Intergenic
978830457 4:113077985-113078007 TCCAATTGAGTTTCCCCCCAAGG - Intronic
981078811 4:140618071-140618093 TCCACTTCAGTTTCCCTGCTAGG + Intergenic
981171195 4:141625120-141625142 TCCAATCCCCTTTCCCATCATGG - Intergenic
983062137 4:163172587-163172609 TCCAAACCAGTTTCCTTTCATGG + Intergenic
983461441 4:168029368-168029390 TCCAAACTGGTTTCCTTTCATGG - Intergenic
984855192 4:184189102-184189124 TCCAATCCACTTTCCCAGCACGG - Intronic
986933083 5:12851863-12851885 TCCACTCCAGAGTCCCTTTACGG + Intergenic
987011383 5:13769598-13769620 TCCAATCCAGTATTCATTCTGGG + Exonic
988072952 5:26317895-26317917 TAAAATCCAGTATCCCTTTATGG - Intergenic
988467391 5:31503418-31503440 GCCCATCTAGTCTCCCTTCAAGG + Intronic
989669565 5:43899647-43899669 ACTAATCAAGTATCCCTTCATGG - Intergenic
993707385 5:91186426-91186448 TACCTTCCACTTTCCCTTCACGG - Intergenic
995487003 5:112649308-112649330 TCCAAACCAGCTTCCATTCCAGG + Intergenic
996714046 5:126572275-126572297 TCCAATCCAGGATCCAATCAAGG + Intronic
999665203 5:153905579-153905601 TCAAATCCTTCTTCCCTTCAGGG - Intergenic
1001872982 5:175173246-175173268 TCCAATCCTGTTTCCTTTTAGGG + Intergenic
1003808998 6:9758828-9758850 TCTAATCCAGTTTGCCTTTTAGG - Intronic
1006289567 6:33124244-33124266 TTCATACCAGTTTCCTTTCATGG - Intergenic
1006384210 6:33720158-33720180 TCCACTCCTGTCACCCTTCAGGG + Intergenic
1007004723 6:38350017-38350039 TCCAACCCAGGATCCCTTCTTGG + Intronic
1008187727 6:48414772-48414794 TCCAATTCAATTTCCATTCTAGG + Intergenic
1008228071 6:48946727-48946749 TCCATTCCTGTTTCCTTGCAAGG - Intergenic
1008840506 6:55897469-55897491 TCTACTCCTGTTTCTCTTCAGGG + Intergenic
1009349336 6:62654072-62654094 TCTAAACCAGTTTCCTTTCATGG - Intergenic
1010682454 6:78812488-78812510 TTCATTCCACTTTCCGTTCACGG + Intergenic
1010932675 6:81821193-81821215 TTCAATTCAGTTTCTTTTCATGG + Intergenic
1013814024 6:114076158-114076180 TCCATTTCATGTTCCCTTCAAGG + Intronic
1016109202 6:140201039-140201061 CTCAATCCAGTTTCCCTTAATGG + Intergenic
1017185635 6:151597985-151598007 TCCACTGTAGTTTCCCTTCTGGG + Intronic
1018220286 6:161571334-161571356 TACAATCCAGTTTCCTTACTAGG - Intronic
1018560441 6:165096798-165096820 TTCAATTCAGTTTCCATTCATGG + Intergenic
1018728387 6:166630892-166630914 TCCACTACAGTTTACCTTCTAGG - Intronic
1019042557 6:169118967-169118989 TCCAATCTGGTTTTCCTTCTAGG - Intergenic
1019253390 7:32951-32973 TCCAACCCAGATGCGCTTCATGG + Intergenic
1020351341 7:7222055-7222077 TCCTGTCCTGTTTCCCTACAAGG + Intronic
1021275839 7:18649778-18649800 TCCAATCCATGCTTCCTTCATGG - Intronic
1023286020 7:38620756-38620778 TCCAACCCAGTATGCTTTCATGG - Intronic
1025164568 7:56701491-56701513 TCCAACCCTCCTTCCCTTCATGG - Intergenic
1025705708 7:63860585-63860607 TCCAACCCTCCTTCCCTTCATGG + Intergenic
1028447233 7:90939696-90939718 TGCAAGCAAGTTTCCCTTCAAGG + Intronic
1029165995 7:98591269-98591291 CTCAATTCAGTTTACCTTCATGG + Intergenic
1030117355 7:106072008-106072030 TCCAAACCAGCTTCCATTCTCGG - Intergenic
1030724028 7:112903423-112903445 TTCAATCCAGGATCCCATCAGGG - Intronic
1032637373 7:133724662-133724684 TTCAGTCCACTTTACCTTCATGG - Intronic
1033904234 7:146182156-146182178 TCCTCTCCAGTTTGCTTTCAGGG - Intronic
1034230943 7:149528084-149528106 TCCAATCCAGTTTCCTTTCATGG + Intergenic
1038649769 8:29391736-29391758 TTCAATCCTGTTTCCCTGCAAGG - Intergenic
1039902381 8:41762253-41762275 TCCAATCTTTCTTCCCTTCAAGG + Intronic
1040094487 8:43430784-43430806 TTCAAACCAATTTTCCTTCATGG + Intergenic
1040397567 8:47014079-47014101 TTCAAACCGGTTTCTCTTCATGG - Intergenic
1040417578 8:47208694-47208716 TCAACTCCAGCTTCCCATCATGG - Intergenic
1042028062 8:64444845-64444867 TCTATTCCAGTTACCCTACATGG - Intergenic
1044008585 8:86965397-86965419 TCCAACCCAGTTTCACTTCATGG - Intronic
1044591723 8:93919104-93919126 TCCACTACATTTTTCCTTCAAGG - Intronic
1048290899 8:133181069-133181091 TGGAATCCAGTGTCCCTTTATGG + Intergenic
1051029481 9:12657699-12657721 TCCAATCCAGTTTCCCTTCATGG - Intergenic
1051328128 9:15995306-15995328 TCCAGTCCAGTCTCCTTACAGGG + Intronic
1051516677 9:17937448-17937470 CCAAATCTAGTTGCCCTTCAGGG - Intergenic
1054475588 9:65570427-65570449 TGCAATCCAGCTTCTCTTCCTGG - Intergenic
1058629405 9:106970987-106971009 TCCAAACAAGTTTCCCTGAAAGG - Intronic
1202799547 9_KI270719v1_random:163070-163092 TCCTATCCTGTGTCCCTTGATGG - Intergenic
1187644968 X:21337179-21337201 TAAAATTCAGTATCCCTTCATGG + Intergenic
1188755415 X:33955548-33955570 TCACATCCAGTCTCCCTTCATGG + Intergenic
1190126759 X:47712302-47712324 GCTAATCCAGTTTGCCTCCAAGG - Intergenic
1192146949 X:68688586-68688608 TCCTTTCCAGTGTCCCTCCAGGG - Intronic
1192606161 X:72520728-72520750 TCCAATTCAGAATCCATTCAAGG + Intronic
1193468550 X:81874060-81874082 TCCAACTCAGTTTCCCTTCTTGG - Intergenic
1193574846 X:83184759-83184781 TTCCAATCAGTTTCCCTTCATGG - Intergenic
1193696257 X:84710175-84710197 TCCAACCCCGCTTCCCATCATGG + Intergenic
1193789358 X:85799838-85799860 TCTATTCCTGTTTCCCTTGAGGG + Intergenic
1193834402 X:86323750-86323772 TCCAAGCAAGTTTCCTTTAATGG - Intronic
1194436694 X:93875407-93875429 TCCAATCTAGTTTCCTTCCATGG - Intergenic
1195560399 X:106276514-106276536 TGCCATGCAGTTTCCTTTCAGGG + Intergenic
1195561563 X:106289825-106289847 TGCCATGCAGTTTCCTTTCAGGG - Intergenic
1197145961 X:123172587-123172609 TCCAATCTAGTATCTTTTCATGG - Intergenic
1197283594 X:124567343-124567365 TCCATCCCAGTTTCCTTTGATGG - Intronic
1198191313 X:134309654-134309676 TTCAAACTAGTTTCCTTTCATGG + Intergenic
1200971795 Y:9160602-9160624 TCCAATTCAGTTTTCTTTCATGG - Intergenic
1201060425 Y:10038990-10039012 TCCCAGCCAGTTTCCCTCCCTGG - Intergenic
1201928731 Y:19318138-19318160 TCGAATCCAGTTTTCTTTCATGG + Intergenic
1201975515 Y:19844496-19844518 TTCAGTCCAGTTTGCTTTCATGG - Intergenic