ID: 1051029482

View in Genome Browser
Species Human (GRCh38)
Location 9:12657706-12657728
Sequence GGGAAACTGGATTGGAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051029467_1051029482 23 Left 1051029467 9:12657660-12657682 CCCAGAACTTCCTTCCAACCCCA No data
Right 1051029482 9:12657706-12657728 GGGAAACTGGATTGGAACAAAGG No data
1051029465_1051029482 29 Left 1051029465 9:12657654-12657676 CCTTGCCCCAGAACTTCCTTCCA No data
Right 1051029482 9:12657706-12657728 GGGAAACTGGATTGGAACAAAGG No data
1051029468_1051029482 22 Left 1051029468 9:12657661-12657683 CCAGAACTTCCTTCCAACCCCAC No data
Right 1051029482 9:12657706-12657728 GGGAAACTGGATTGGAACAAAGG No data
1051029473_1051029482 4 Left 1051029473 9:12657679-12657701 CCCACCCAATGGCTAGATCTCCA No data
Right 1051029482 9:12657706-12657728 GGGAAACTGGATTGGAACAAAGG No data
1051029470_1051029482 13 Left 1051029470 9:12657670-12657692 CCTTCCAACCCCACCCAATGGCT No data
Right 1051029482 9:12657706-12657728 GGGAAACTGGATTGGAACAAAGG No data
1051029474_1051029482 3 Left 1051029474 9:12657680-12657702 CCACCCAATGGCTAGATCTCCAT No data
Right 1051029482 9:12657706-12657728 GGGAAACTGGATTGGAACAAAGG No data
1051029475_1051029482 0 Left 1051029475 9:12657683-12657705 CCCAATGGCTAGATCTCCATGAA No data
Right 1051029482 9:12657706-12657728 GGGAAACTGGATTGGAACAAAGG No data
1051029464_1051029482 30 Left 1051029464 9:12657653-12657675 CCCTTGCCCCAGAACTTCCTTCC No data
Right 1051029482 9:12657706-12657728 GGGAAACTGGATTGGAACAAAGG No data
1051029476_1051029482 -1 Left 1051029476 9:12657684-12657706 CCAATGGCTAGATCTCCATGAAG No data
Right 1051029482 9:12657706-12657728 GGGAAACTGGATTGGAACAAAGG No data
1051029471_1051029482 9 Left 1051029471 9:12657674-12657696 CCAACCCCACCCAATGGCTAGAT No data
Right 1051029482 9:12657706-12657728 GGGAAACTGGATTGGAACAAAGG No data
1051029466_1051029482 24 Left 1051029466 9:12657659-12657681 CCCCAGAACTTCCTTCCAACCCC No data
Right 1051029482 9:12657706-12657728 GGGAAACTGGATTGGAACAAAGG No data
1051029472_1051029482 5 Left 1051029472 9:12657678-12657700 CCCCACCCAATGGCTAGATCTCC No data
Right 1051029482 9:12657706-12657728 GGGAAACTGGATTGGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051029482 Original CRISPR GGGAAACTGGATTGGAACAA AGG Intergenic
No off target data available for this crispr