ID: 1051029483

View in Genome Browser
Species Human (GRCh38)
Location 9:12657726-12657748
Sequence AGGCAACATTCCCAACACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051029472_1051029483 25 Left 1051029472 9:12657678-12657700 CCCCACCCAATGGCTAGATCTCC No data
Right 1051029483 9:12657726-12657748 AGGCAACATTCCCAACACCCAGG No data
1051029474_1051029483 23 Left 1051029474 9:12657680-12657702 CCACCCAATGGCTAGATCTCCAT No data
Right 1051029483 9:12657726-12657748 AGGCAACATTCCCAACACCCAGG No data
1051029471_1051029483 29 Left 1051029471 9:12657674-12657696 CCAACCCCACCCAATGGCTAGAT No data
Right 1051029483 9:12657726-12657748 AGGCAACATTCCCAACACCCAGG No data
1051029475_1051029483 20 Left 1051029475 9:12657683-12657705 CCCAATGGCTAGATCTCCATGAA No data
Right 1051029483 9:12657726-12657748 AGGCAACATTCCCAACACCCAGG No data
1051029481_1051029483 4 Left 1051029481 9:12657699-12657721 CCATGAAGGGAAACTGGATTGGA 0: 6
1: 6
2: 7
3: 36
4: 182
Right 1051029483 9:12657726-12657748 AGGCAACATTCCCAACACCCAGG No data
1051029473_1051029483 24 Left 1051029473 9:12657679-12657701 CCCACCCAATGGCTAGATCTCCA No data
Right 1051029483 9:12657726-12657748 AGGCAACATTCCCAACACCCAGG No data
1051029476_1051029483 19 Left 1051029476 9:12657684-12657706 CCAATGGCTAGATCTCCATGAAG No data
Right 1051029483 9:12657726-12657748 AGGCAACATTCCCAACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051029483 Original CRISPR AGGCAACATTCCCAACACCC AGG Intergenic
No off target data available for this crispr