ID: 1051035065

View in Genome Browser
Species Human (GRCh38)
Location 9:12734538-12734560
Sequence CCTTATAAGCAAAAGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051035062_1051035065 18 Left 1051035062 9:12734497-12734519 CCTGCATTCTCTGGGTAGGCTCT No data
Right 1051035065 9:12734538-12734560 CCTTATAAGCAAAAGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051035065 Original CRISPR CCTTATAAGCAAAAGGCAGC AGG Intergenic
No off target data available for this crispr