ID: 1051035188

View in Genome Browser
Species Human (GRCh38)
Location 9:12736053-12736075
Sequence GAGTGCAAGCAGATGGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051035188_1051035192 22 Left 1051035188 9:12736053-12736075 CCCAATTCCATCTGCTTGCACTC No data
Right 1051035192 9:12736098-12736120 ACATGTGATACCTGTAGGCAAGG No data
1051035188_1051035191 17 Left 1051035188 9:12736053-12736075 CCCAATTCCATCTGCTTGCACTC No data
Right 1051035191 9:12736093-12736115 GCTTTACATGTGATACCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051035188 Original CRISPR GAGTGCAAGCAGATGGAATT GGG (reversed) Intergenic
No off target data available for this crispr