ID: 1051035218 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:12736517-12736539 |
| Sequence | CTGCATTAGCCTTAGGTAGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1051035216_1051035218 | -7 | Left | 1051035216 | 9:12736501-12736523 | CCAATGTGAGTATGATCTGCATT | No data | ||
| Right | 1051035218 | 9:12736517-12736539 | CTGCATTAGCCTTAGGTAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1051035218 | Original CRISPR | CTGCATTAGCCTTAGGTAGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||