ID: 1051035218

View in Genome Browser
Species Human (GRCh38)
Location 9:12736517-12736539
Sequence CTGCATTAGCCTTAGGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051035216_1051035218 -7 Left 1051035216 9:12736501-12736523 CCAATGTGAGTATGATCTGCATT No data
Right 1051035218 9:12736517-12736539 CTGCATTAGCCTTAGGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051035218 Original CRISPR CTGCATTAGCCTTAGGTAGA TGG Intergenic
No off target data available for this crispr