ID: 1051036391

View in Genome Browser
Species Human (GRCh38)
Location 9:12751491-12751513
Sequence TTGAATAAACATGAAGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051036388_1051036391 4 Left 1051036388 9:12751464-12751486 CCATATTGTACTGTCCAAGACTT No data
Right 1051036391 9:12751491-12751513 TTGAATAAACATGAAGAGAGTGG No data
1051036390_1051036391 -10 Left 1051036390 9:12751478-12751500 CCAAGACTTCTGGTTGAATAAAC No data
Right 1051036391 9:12751491-12751513 TTGAATAAACATGAAGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051036391 Original CRISPR TTGAATAAACATGAAGAGAG TGG Intergenic
No off target data available for this crispr