ID: 1051039219

View in Genome Browser
Species Human (GRCh38)
Location 9:12785665-12785687
Sequence AGGGAGAATACAGTGATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 1, 2: 22, 3: 106, 4: 356}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051039219_1051039225 27 Left 1051039219 9:12785665-12785687 CCCATAATCACTGTATTCTCCCT 0: 1
1: 1
2: 22
3: 106
4: 356
Right 1051039225 9:12785715-12785737 CTCTGCAGTGCTGCACTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051039219 Original CRISPR AGGGAGAATACAGTGATTAT GGG (reversed) Intronic
900316448 1:2059580-2059602 CGGGAGAAGACAGTGAGTACTGG + Exonic
903757470 1:25672631-25672653 AGGGAGATTAGCCTGATTATCGG - Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
906854477 1:49289832-49289854 AGGAAGAACACAGTAAATATAGG + Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909209810 1:72808753-72808775 AGGGGGAAGAAAGTGATTGTGGG - Intergenic
909567835 1:77075530-77075552 AGGGAGAATAGAGGTAATATAGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910163809 1:84301313-84301335 AGTGAGAAGCCAGTGCTTATGGG - Intronic
910228622 1:84963393-84963415 AGAGAGAAGATAGTGAGTATGGG + Intronic
910321685 1:85953061-85953083 ATGGAGAATACATTGCTTGTTGG - Intronic
910384225 1:86664350-86664372 AGGCAGAGCACAGTGATTACAGG + Intergenic
910384430 1:86665570-86665592 AGGCAGAGCACAGTGATTACAGG - Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910476836 1:87616518-87616540 TGGGAGAGCAGAGTGATTATAGG + Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911019729 1:93374634-93374656 GGGGAGAGCACAGTTATTATGGG + Intergenic
911294454 1:96097630-96097652 AGGGAGGACCCAGTGAATATGGG - Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
912932027 1:113972765-113972787 AGGGAGAATCAAGAGATCATAGG - Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915931710 1:160064829-160064851 AGGGAGAATGCAGTGCTAAGAGG + Intronic
917171677 1:172183445-172183467 AAGGAAAATACAGTGATTCTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918037946 1:180893860-180893882 AGGGAGGAGACAGTAACTATGGG + Intergenic
918171478 1:182002288-182002310 AGGGACAATACAGCAATAATGGG - Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
919835372 1:201569621-201569643 AGGGAAGGTACAGTGATTCTGGG + Intergenic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
921494385 1:215820711-215820733 AGGAAGAATAGATTGATTAATGG - Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
924481583 1:244439954-244439976 CAGGAGAATGCAGTGATCATAGG - Intronic
924861620 1:247929490-247929512 AGTAAGAATATAGTAATTATAGG + Intergenic
1063469021 10:6269553-6269575 GGGGAAAATGCAGTGAATATAGG + Intergenic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1066194728 10:33088175-33088197 AGGTAGAATAGAGTGACTCTAGG - Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1068647320 10:59482020-59482042 AGGGAGAAAACAAGGGTTATGGG + Intergenic
1070464134 10:76702878-76702900 AAGGAGAGTGCAGTGATCATGGG + Intergenic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1071778322 10:88813976-88813998 ATGGGGATTACAGGGATTATGGG + Intronic
1072350131 10:94549268-94549290 TGGGAGAATACAGTCTGTATGGG + Intronic
1072800561 10:98389662-98389684 AGTGAGAATACAGATCTTATGGG - Intronic
1072844398 10:98813484-98813506 ATGGAGAAGGCAGTGATTTTGGG - Intronic
1073869328 10:107844674-107844696 AGAGAGAATACCGGGATTGTTGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076242795 10:128922450-128922472 TTGGAGAATACAGTGATTCTGGG - Intergenic
1078277778 11:9867070-9867092 AGGGTGACTACAGTAATTAATGG + Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080022287 11:27575162-27575184 AGACAGAATACAGTGGATATAGG - Intergenic
1080273818 11:30480722-30480744 AGGAAGAACACAGTTTTTATTGG - Intronic
1080966640 11:37220567-37220589 AGAGAGAATGCAGTGATCGTGGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081589595 11:44411991-44412013 AGGGAAAATAAAGAGATTATAGG - Intergenic
1082626569 11:55494611-55494633 GGGGAGTGTACAGTGTTTATTGG - Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1084467686 11:69335826-69335848 AGGGAGGAGACAGTCATTGTTGG - Intronic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1085217539 11:74845448-74845470 AGAGGGAATACAGTGGTTTTGGG + Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1088946990 11:114524293-114524315 AAGGAGAAGGCAGTGAGTATTGG + Intronic
1089474842 11:118751004-118751026 AAGGGGATTAGAGTGATTATGGG - Exonic
1089784117 11:120895783-120895805 TGGGAGAATTCAGAGATGATAGG + Intronic
1089819157 11:121207155-121207177 ACAGAGAATACTGTGTTTATAGG - Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090923093 11:131224482-131224504 AGGGATAATACAGGGATTGCAGG + Intergenic
1091541516 12:1466665-1466687 AGGGAGTATTCAGTAATTACTGG - Intronic
1092156447 12:6284830-6284852 GGGTAGAATACAGTGATGTTAGG - Intergenic
1092497512 12:9011815-9011837 AGGAAGAGTGCTGTGATTATGGG + Intergenic
1092769708 12:11885422-11885444 AGCAAGAATACAGTGGTTCTGGG - Intronic
1092991208 12:13901833-13901855 AGGTAAAATACAGAGACTATAGG - Intronic
1093051138 12:14506282-14506304 ATGGGGAAGAGAGTGATTATTGG + Intronic
1093520277 12:20041999-20042021 ATGGGAAATACAGTGTTTATGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1095812106 12:46382985-46383007 AGGGAGAAGACGGTGACGATGGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1097747605 12:63317388-63317410 AGGAAGGATACGGTGATTAAAGG - Intergenic
1098669193 12:73203268-73203290 AGGAATAATACAGTGGTTACGGG - Intergenic
1098739322 12:74151869-74151891 AGGGAGAAAAAAGTCATTGTGGG + Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099781570 12:87202330-87202352 TGAGATAATACAGTGATTGTGGG + Intergenic
1099935864 12:89124577-89124599 AGGGAGAATGAAGTGTGTATTGG - Intergenic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1101469546 12:104983800-104983822 AGGAAGAAAACACTGATTAATGG - Intergenic
1102437541 12:112937062-112937084 AGGAAGAAGACTGTGATTAATGG + Intergenic
1102501095 12:113353035-113353057 AGGAAGAATACTGTGATATTAGG - Intronic
1102786495 12:115609253-115609275 AGGGAAAATAGAGTGGATATTGG - Intergenic
1102791361 12:115648838-115648860 AATGAGAATCCAGTGATAATGGG + Intergenic
1103063215 12:117875608-117875630 AGGGAGAAGGCAGCGATTATGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108177942 13:47813077-47813099 AGGGAGAATAAAGTTGTCATTGG - Intergenic
1108741253 13:53340930-53340952 AGGGAGAATACAGTTATTTCAGG + Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111296012 13:86278664-86278686 AAGGAGATTAGAGTGATTATAGG + Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1115020143 14:28669972-28669994 AGAGAGAATAAAGTGAATAAAGG + Intergenic
1115801507 14:36999393-36999415 TGGCAGAAAACAGTGATTTTAGG + Intronic
1115955295 14:38771719-38771741 AGGGAGAAAACATTTAATATTGG - Intergenic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117499315 14:56336533-56336555 AAAGAGAATGAAGTGATTATAGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118046656 14:61977620-61977642 ATGGGGATTACAGGGATTATGGG + Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119070889 14:71582801-71582823 AGGGAGAATACAGAAATGAAAGG + Intronic
1122263576 14:100536487-100536509 AGGGAGAAAACAGAGAGAATGGG + Intergenic
1126486648 15:49188430-49188452 TGGAGGAGTACAGTGATTATGGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1126770587 15:52051972-52051994 AGGAACAATACTGTGATTAGAGG + Intronic
1126865414 15:52932051-52932073 AGGGAACACAGAGTGATTATAGG + Intergenic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1129477594 15:75796541-75796563 AGGGAGAATACAGCAACTGTGGG - Intergenic
1130007661 15:80116230-80116252 AGGGAGAAAACACTGATTTTTGG - Intronic
1132137383 15:99355020-99355042 AGGGAGAATAGAGAGACAATGGG + Intronic
1137226487 16:46516274-46516296 ACAGAGAAGACAGAGATTATTGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1141205084 16:81927307-81927329 AGGGAAGACACAGTGATGATAGG + Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143878828 17:10014164-10014186 TGGGACCATACAGTGAGTATAGG - Intronic
1145183977 17:20778521-20778543 ATGGGGATTATAGTGATTATGGG - Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146101565 17:29987610-29987632 GGGGGGAAAACAGGGATTATGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1146388472 17:32399049-32399071 ATGAAGAATACAGTGACTACTGG + Intergenic
1146611341 17:34307662-34307684 AGTGAGAATATAGTGATCAGAGG - Intergenic
1146886505 17:36474538-36474560 AGGAAGGATATAGTGATTAAAGG - Intergenic
1148450370 17:47773774-47773796 AGGAAGTATACAGTGATGATGGG - Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149370054 17:55985034-55985056 AGGGAGAAAGGAGTGATCATGGG + Intergenic
1149570684 17:57670204-57670226 AGGGACAACACAGAAATTATTGG + Intronic
1150175724 17:63053466-63053488 GGGGAGAATACTGTGAGAATAGG - Intronic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155046069 18:22104317-22104339 AGATACAATACAGTGACTATAGG + Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1156357056 18:36350975-36350997 AGGAAGAACACAGTGCTTCTTGG - Intronic
1157492064 18:48130387-48130409 AGGGAGAAGAAAGTGATGCTAGG + Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158753306 18:60291469-60291491 TATGTGAATACAGTGATTATGGG - Intergenic
1158942548 18:62418941-62418963 AGGGAGAATGCAAAGATTAGTGG - Intergenic
1159338548 18:67102834-67102856 AGGCAGGATAAAGTTATTATTGG + Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1159981473 18:74786503-74786525 AGGAAAAATAAAGTGTTTATGGG + Intronic
1164588273 19:29491275-29491297 AGTGAGAACAAAGTGATTCTGGG + Intergenic
1167007823 19:46787147-46787169 AGGGAGAAGAAAGTGATTTGGGG - Intronic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
926318041 2:11725803-11725825 AGGGAGAAAAAAGTGATTCCGGG - Intronic
926320042 2:11743345-11743367 AGGGAGAGGACAGTGATCCTCGG - Intronic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
926858091 2:17279439-17279461 AGGCAGAATACAGGGATAAATGG + Intergenic
927162580 2:20281719-20281741 AGGGAAAATCCAGTGAACATGGG - Intronic
927243736 2:20940464-20940486 AGGGAAAATGCAGGGATTACGGG + Intergenic
928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930331404 2:49989759-49989781 AGTGAGAATAAAGTTATGATTGG + Intronic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931773839 2:65523045-65523067 AGGGAGCGTACAGTAAGTATGGG - Intergenic
934014677 2:87866911-87866933 AGGAAGGATACAGTGATTTAAGG + Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935018945 2:99212132-99212154 AGGGAGAATGAAGTGATCATGGG - Intronic
935478621 2:103557353-103557375 GGGGAGAACACAGTGATAATGGG - Intergenic
935619278 2:105114605-105114627 GGGGAAAATACAGTGATTTTTGG + Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937121838 2:119445707-119445729 CGGGAGAAGCCAGTGATTATAGG - Intronic
938026274 2:127951602-127951624 AAAAGGAATACAGTGATTATAGG - Intronic
940191328 2:151043103-151043125 AGTGAGACTACAGTTATTGTGGG - Intronic
940468568 2:154064074-154064096 ATGGAGAGGCCAGTGATTATAGG + Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941538145 2:166746367-166746389 AGGAAGAAAACAGAGGTTATAGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944929714 2:204504405-204504427 TGGGATAATACACTGATGATGGG + Intergenic
944976089 2:205052986-205053008 AGGGAAAATACAGTGTTCTTTGG + Intronic
945727911 2:213495566-213495588 AGGGAGATTACATTGATTGAAGG + Intronic
946998914 2:225430144-225430166 ATGTAGAATACAATGATTAAAGG + Intronic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169305523 20:4487060-4487082 AGGGAGAATACATGGGTTAATGG - Intergenic
1169415041 20:5408904-5408926 AGGCAGATAACAGGGATTATAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1172520697 20:35563691-35563713 AGGGAGAAAACAGTCTTTATTGG - Intergenic
1174114641 20:48218587-48218609 AGGGAGAATACAGGGAGGACTGG - Intergenic
1174695409 20:52551828-52551850 AGGCAGAGTGCAGTGATGATGGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177110177 21:17017763-17017785 GGGGAGAAAACACAGATTATGGG + Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
949150700 3:763386-763408 AGTGATAATACTGTTATTATTGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952059089 3:29485073-29485095 AGAGAAAATAGAGTTATTATGGG - Intronic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952810747 3:37400409-37400431 AAGTAGAATTCAGTGACTATTGG - Intronic
953064120 3:39453749-39453771 AGGGAGAAAACAGAGAAGATGGG + Intergenic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956086476 3:65616291-65616313 TGGGAAAATACAGTCATGATGGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957582348 3:82090351-82090373 AGGGAGGATACATTTATTAATGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957976229 3:87448189-87448211 AGGAAGAGTAGAGTGATTTTGGG - Intergenic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
958868267 3:99526404-99526426 AGGGAGGACACAGAGAATATAGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959344907 3:105181822-105181844 AGGAAGAATATAAAGATTATGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960862915 3:122169500-122169522 AGGGAGAGTGCAGCAATTATGGG - Intergenic
962038899 3:131683959-131683981 GGGGAAGAGACAGTGATTATGGG - Intronic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963167875 3:142224007-142224029 AGGGGGAATACAGTGCTGCTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964114309 3:153119732-153119754 AGTAAGAATATAGTTATTATAGG + Intergenic
964253588 3:154749446-154749468 AAGGAGAATGCAATGATTATGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964349690 3:155790661-155790683 GGGGAGAGTACATTGATTATGGG + Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965412417 3:168348559-168348581 AGGGAGACCACAGTGTTCATAGG + Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
966988998 3:185209826-185209848 GGAGAGAAGACAGTGGTTATAGG + Intronic
967234880 3:187374433-187374455 AGGTAGAAAAAAGAGATTATGGG - Intergenic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968096043 3:195931515-195931537 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096053 3:195931577-195931599 AGGCAGAGCACAGTGATGATGGG + Intergenic
968096064 3:195931639-195931661 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096075 3:195931701-195931723 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096083 3:195931763-195931785 AGGCAGAGCACAGTGATGATAGG + Intergenic
968726584 4:2250704-2250726 AGGGAGAATAGAGTGGGGATGGG + Intronic
970570104 4:17371763-17371785 AGTGACAAGACAGTGATTCTGGG - Intergenic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972652533 4:41032480-41032502 AAGGAGAATACATTCAGTATTGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974461151 4:62189634-62189656 AGGGAAATTAAAATGATTATTGG - Intergenic
974636285 4:64567712-64567734 AGGGGGGAAACAGCGATTATGGG + Intergenic
975212200 4:71713891-71713913 AAGGAGAATACAAAGAATATGGG + Intergenic
975260942 4:72297997-72298019 GGGAAGAATAAAGTGATTAAGGG + Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975722013 4:77257075-77257097 AGAGAAAATACAGTGTATATAGG - Intronic
976005632 4:80426459-80426481 AGCTAGAATACAGTGAATTTAGG + Intronic
976237625 4:82915810-82915832 AGAGAAAATACAGTATTTATAGG - Intronic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978733686 4:112061326-112061348 AGGGACAGCACAGTGATCATGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979763184 4:124432579-124432601 AGGGAGAATTCTGAGATTCTAGG - Intergenic
980596827 4:134965918-134965940 AGGGAATAAAGAGTGATTATGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
982098890 4:151949247-151949269 AGCAAGAATACATTTATTATAGG - Intergenic
982380922 4:154745907-154745929 AGGTAGATTACATTGTTTATGGG + Intronic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984311197 4:178061782-178061804 AGGCATAATACAATTATTATAGG + Intergenic
984496283 4:180501678-180501700 AGGAAGAATGCAGTGATAGTTGG - Intergenic
985959205 5:3286988-3287010 AGGGAGAATTCAGTGGTGTTTGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986155912 5:5175813-5175835 AGGGAGAGAACAGCGATCATGGG - Intronic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
988616898 5:32783578-32783600 AGGGAGAACAAAGTGAATATAGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992313306 5:75525588-75525610 AGGGAGATGAGAGAGATTATAGG + Intronic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992642461 5:78779970-78779992 AGGGAGCAGACAGTGATTAATGG - Exonic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993222575 5:85120066-85120088 AGAGAGGATAGAGTGATTAGGGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994545089 5:101155934-101155956 GTGGGGAATACAGGGATTATGGG + Intergenic
995017548 5:107328149-107328171 AGGGAGAATATAGTTAATATAGG - Intergenic
995264709 5:110144686-110144708 AAGGAGAAGACAGTGATTAGGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
998937902 5:147250217-147250239 TGGAGGCATACAGTGATTATGGG + Intronic
998958263 5:147458853-147458875 AGGGAGAACACAGTGTATAGGGG + Intronic
999279465 5:150355488-150355510 AGGGAGAAGACAGTGTATGTGGG - Intergenic
999363560 5:151006450-151006472 AAGGAGAAGAAAGTGAGTATGGG - Intergenic
1000063371 5:157675247-157675269 AGGGAGAATGAAATGAATATGGG - Intronic
1003432894 6:6056366-6056388 AGGTAGAATACAGTGAGGAAAGG - Intergenic
1005096074 6:22117920-22117942 AGGTAGAATACAGTTTTAATAGG + Intergenic
1005793155 6:29328261-29328283 AAGGGGATTAGAGTGATTATGGG - Intergenic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008744593 6:54654306-54654328 AGGGAAAATACAGTTATTTAAGG + Intergenic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010088792 6:71953617-71953639 AGGGAAAGTACAGTGGTAATGGG - Intronic
1010596402 6:77769199-77769221 AGAGAGAACATACTGATTATGGG + Intronic
1012827233 6:104162173-104162195 AGGGAGAACGCAGTGACCATGGG + Intergenic
1013899253 6:115133250-115133272 AAGAAGAATACAATGATTACTGG + Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014865714 6:126527100-126527122 AGAAAGAAGACAGTAATTATGGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016119011 6:140324760-140324782 ATGGAGATTACAATGATTTTAGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1018414869 6:163592015-163592037 AGGGAGCAAACAGTGGTTTTGGG - Intergenic
1019381342 7:725953-725975 AGGGAGAGGGCAGTGCTTATTGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021045028 7:15912301-15912323 AGGGAAAATGCATTGATTAATGG + Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021859660 7:24893835-24893857 TGGGAGAAGCCAGTGATTCTAGG - Intronic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022296614 7:29061533-29061555 AAGGAGAATATATTGATTAGAGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026441251 7:70446297-70446319 GGGGAGAATATAGTGTTTATCGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028266700 7:88734305-88734327 AGGAAGACTGTAGTGATTATGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1030945073 7:115708391-115708413 AGAGAGAAAAAAGTAATTATGGG - Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031565838 7:123296173-123296195 AGGGAGAGTAAAGTGATGATGGG + Intergenic
1031657735 7:124379452-124379474 AGTGAGACCACAGTGATCATGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1032274431 7:130441531-130441553 TGGGTAAATACAGTAATTATCGG + Intronic
1033488042 7:141811057-141811079 AGTGAGAATACCGTGATCAAGGG - Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035147372 7:156833024-156833046 AGGTAGAATGCACTGTTTATTGG + Intronic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1039339300 8:36629302-36629324 GTGGAGAAGACAGTGATTTTTGG + Intergenic
1039659707 8:39448852-39448874 AGGAAGAATACAAGGATTAAAGG + Intergenic
1041395080 8:57381568-57381590 AGGTGGAATTCAGTGGTTATGGG - Intergenic
1041531225 8:58869776-58869798 TGTTAGAATACATTGATTATTGG - Intronic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1041852353 8:62405565-62405587 ACGGAGAGAGCAGTGATTATGGG - Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045724774 8:105159609-105159631 AGGGAGATTTCAGTGATGAAAGG - Intronic
1046215617 8:111141604-111141626 AGAGAGAGTGAAGTGATTATAGG - Intergenic
1046504674 8:115122224-115122246 AGGGAGATTAAAGTGATTTGGGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1046820931 8:118633564-118633586 AGGTACAATACAGTGAGTAGGGG - Intergenic
1047093171 8:121595809-121595831 AGGGAGAATATTGTGAATTTGGG + Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1049966240 9:782707-782729 AGGGAACATACAGTGTTGATGGG + Intergenic
1050168451 9:2790947-2790969 AGGGAGAATCCAGGGCTCATGGG + Intronic
1050230674 9:3522670-3522692 AGGCAGAATATAATGATTTTTGG - Intronic
1050289224 9:4136762-4136784 AGGGAGAAGACAGAGCTTAGAGG + Intronic
1050644410 9:7703295-7703317 AGGGAGAATACAGTCACTGAGGG - Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051229920 9:14945379-14945401 AAAGAGAAAGCAGTGATTATGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1054741607 9:68811505-68811527 ATGGAGAAGACAGTCACTATTGG - Intronic
1054848046 9:69817852-69817874 AGGTTGAAAACAGTGAGTATAGG + Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055213440 9:73828728-73828750 AATGACAATACACTGATTATGGG + Intergenic
1055464308 9:76549171-76549193 AGTGAGAACACAAAGATTATAGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1058589102 9:106542521-106542543 AGGCATGATACAGTGCTTATTGG + Intergenic
1058616238 9:106831014-106831036 AGGGAGAACTCAGTGATTCAGGG - Intergenic
1058828275 9:108793997-108794019 AGGAAGGATACAGTCATTAAAGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1186602260 X:11050303-11050325 AAGGAGAACATAGTGATCATGGG - Intergenic
1187052306 X:15707181-15707203 AGCCAGAACACAGTGATTATTGG - Intronic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188979805 X:36716792-36716814 ATGGAGTATTCAGTGAGTATAGG + Intergenic
1189109057 X:38268164-38268186 AGTGAGAACTCAGTCATTATGGG - Intronic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190337653 X:49271989-49272011 AGGGAGAATCTAGTGATCCTGGG - Intronic
1190498451 X:51051566-51051588 AAAGAGAGTAAAGTGATTATGGG + Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1192134944 X:68588515-68588537 AGGAAGAACACAGTGACTAGGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192551724 X:72059881-72059903 AGTGAGGATACAGTGAGTTTGGG - Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193098221 X:77578040-77578062 AAGGAGAGTGCAGTGATCATAGG + Intronic
1193107125 X:77688631-77688653 AGGGGAGATACTGTGATTATGGG - Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195039590 X:101002008-101002030 AGGGAGACTCCAGTGGTGATGGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195722225 X:107878071-107878093 GGGAAGAATACAGTGATTAAAGG - Intronic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197435761 X:126425959-126425981 AGGGAGAAAACAGCAATTATGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1199129801 X:144171600-144171622 AGGAAGGATACAGTGATTTAAGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1201625805 Y:16013026-16013048 ATGGAGATTATAGTAATTATAGG - Intergenic