ID: 1051041313

View in Genome Browser
Species Human (GRCh38)
Location 9:12815642-12815664
Sequence TCAACTAGTCAGATAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051041313_1051041314 -6 Left 1051041313 9:12815642-12815664 CCTGCTTTTATCTGACTAGTTGA 0: 1
1: 0
2: 2
3: 18
4: 114
Right 1051041314 9:12815659-12815681 AGTTGACATTCATAAATAAAAGG No data
1051041313_1051041315 -5 Left 1051041313 9:12815642-12815664 CCTGCTTTTATCTGACTAGTTGA 0: 1
1: 0
2: 2
3: 18
4: 114
Right 1051041315 9:12815660-12815682 GTTGACATTCATAAATAAAAGGG No data
1051041313_1051041316 7 Left 1051041313 9:12815642-12815664 CCTGCTTTTATCTGACTAGTTGA 0: 1
1: 0
2: 2
3: 18
4: 114
Right 1051041316 9:12815672-12815694 AAATAAAAGGGTAACAATAATGG No data
1051041313_1051041318 13 Left 1051041313 9:12815642-12815664 CCTGCTTTTATCTGACTAGTTGA 0: 1
1: 0
2: 2
3: 18
4: 114
Right 1051041318 9:12815678-12815700 AAGGGTAACAATAATGGAGGAGG No data
1051041313_1051041317 10 Left 1051041313 9:12815642-12815664 CCTGCTTTTATCTGACTAGTTGA 0: 1
1: 0
2: 2
3: 18
4: 114
Right 1051041317 9:12815675-12815697 TAAAAGGGTAACAATAATGGAGG No data
1051041313_1051041319 14 Left 1051041313 9:12815642-12815664 CCTGCTTTTATCTGACTAGTTGA 0: 1
1: 0
2: 2
3: 18
4: 114
Right 1051041319 9:12815679-12815701 AGGGTAACAATAATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051041313 Original CRISPR TCAACTAGTCAGATAAAAGC AGG (reversed) Intronic
902064615 1:13674066-13674088 TCAAAAATACAGATAAAAGCTGG - Intergenic
904924693 1:34038218-34038240 TAATCTTGTCAGATAAAAGATGG - Intronic
907797305 1:57730441-57730463 TCAACTAGTCAGAGCGAAGAGGG + Intronic
907947130 1:59146480-59146502 TCTAGAAGTCAGATAAAAGTAGG + Intergenic
908654747 1:66376146-66376168 TCAGCCAGTAAGATAAAACCAGG - Intergenic
910117349 1:83746725-83746747 TCTCCTAGTCAGATCAAAGGTGG + Intergenic
910850682 1:91647195-91647217 TCAGCTAGTCTGATTGAAGCAGG - Intergenic
917589512 1:176462017-176462039 TTAATTAATCACATAAAAGCAGG - Intergenic
919968550 1:202554571-202554593 TCCAAAAGTCAGGTAAAAGCTGG + Intronic
920648940 1:207822633-207822655 TCAACTGGGCAGTCAAAAGCAGG + Intergenic
920920767 1:210295527-210295549 CAAACTTGTCAGAGAAAAGCTGG - Intergenic
921352785 1:214254741-214254763 GGAACTAATCAGATAAAAGGGGG - Intergenic
922934199 1:229411198-229411220 TTAACGAGTCAGATATGAGCAGG + Intergenic
924718080 1:246597194-246597216 TCAAATAGTCAGATATTAACAGG - Intronic
1064241852 10:13637532-13637554 TAAATCAGTCAGAAAAAAGCAGG - Intronic
1064462050 10:15544558-15544580 TTCTCTAGTCAGATGAAAGCTGG - Intronic
1066131422 10:32397930-32397952 TAAACTAGTCAGAAAAAACTGGG + Intergenic
1070194435 10:74143771-74143793 TCTACAAGGCAGATAAGAGCAGG - Intronic
1072699838 10:97632938-97632960 TCCACCAGTGAGATAAAGGCGGG + Intronic
1079463543 11:20706706-20706728 TCTACAAGTCAGAAAAAAGTGGG - Intronic
1080838779 11:35965158-35965180 TCATCTGATCAAATAAAAGCGGG - Intronic
1081715246 11:45245627-45245649 TCAGCTAGCCAGATAATACCTGG - Intronic
1083203615 11:61134343-61134365 TCAACTAGTCAGACAAAGCCAGG + Intronic
1084639562 11:70416720-70416742 TCAACTGCTCAGGTAAAAGCTGG - Intronic
1090122835 11:124050717-124050739 TCAACCAGCCAGATTAAATCAGG - Intergenic
1091609735 12:1995713-1995735 TCAGCTGGAAAGATAAAAGCAGG - Intronic
1093750698 12:22796198-22796220 TGAACAGGGCAGATAAAAGCAGG + Intergenic
1095640658 12:44481873-44481895 TGACCTAGTGAGATACAAGCTGG - Intergenic
1098742736 12:74194607-74194629 TCAACCAGACAGATCAAAGCTGG - Intergenic
1099663739 12:85599127-85599149 TCAACTAGACATATAAAATTAGG - Intergenic
1108902467 13:55429084-55429106 TGAACTAGTTAAATAAAAGATGG + Intergenic
1109249044 13:59996076-59996098 TCAACTGGTCAAATAAAACAAGG + Intronic
1110111315 13:71749451-71749473 TGAACAAATCAGATAAAACCTGG + Intronic
1110275306 13:73635602-73635624 GCAACTAGTCAGACATGAGCAGG + Intergenic
1117268918 14:54121192-54121214 TCAAGTTGCCAGCTAAAAGCAGG - Intergenic
1119891677 14:78187370-78187392 TCAACTAGTAAACAAAAAGCAGG - Intergenic
1125041738 15:35195766-35195788 TCAACCAGTCAGAGCAGAGCAGG - Intergenic
1125612079 15:40978353-40978375 TCACCCAGTCAGAGAAACGCTGG + Intergenic
1128426636 15:67547880-67547902 TCTACTAGTCATTTTAAAGCAGG - Intronic
1129061169 15:72861400-72861422 TCTAGGACTCAGATAAAAGCGGG - Intergenic
1132154451 15:99485867-99485889 TCAACAAGCAAGATAAAAGGTGG + Intergenic
1137466108 16:48711307-48711329 TCTTGTAGCCAGATAAAAGCAGG + Intergenic
1138815698 16:60200568-60200590 TCACCTAGTCAGACATAAACAGG - Intergenic
1153202332 18:2658590-2658612 CCAACTAGTAAGAAAAAAGAAGG + Intronic
1155551883 18:26973439-26973461 TCAAGTAGTCTCATAAAAGCTGG + Intronic
1165451334 19:35885415-35885437 TCAACAAGTATGATACAAGCAGG + Intergenic
925552857 2:5094881-5094903 TCAAAAAGTCAGATAAATGTTGG + Intergenic
926451284 2:13007346-13007368 TCAACTAGTCAGAGAACAGCTGG - Intergenic
926541028 2:14182211-14182233 TCAACTACTCTGATAAAATGTGG - Intergenic
931032779 2:58199584-58199606 TCAACTAGTCATATAAAAACTGG + Intronic
933561956 2:83898790-83898812 TCAAAAAGTCTGACAAAAGCTGG + Intergenic
937891730 2:126944279-126944301 TCACCTAGTCAGTTGAAACCAGG - Intergenic
941043911 2:160651526-160651548 TCAAGCAGTCAGATGGAAGCAGG - Intergenic
941567951 2:167131893-167131915 TCAAAATATCAGATAAAAGCTGG - Intronic
941944558 2:171080475-171080497 TCAACTATACAGATAAAACCTGG + Intronic
942380282 2:175384038-175384060 GCAACTAGTCAGCTAACAGATGG - Intergenic
943213077 2:184993423-184993445 CCAACTAATCAGAAAAAAGTAGG + Intergenic
944475338 2:200098298-200098320 TCAACTAGTCATATAAGTGTAGG + Intergenic
947342852 2:229157958-229157980 TCAAGAAGTGAGATAAAAACAGG + Intronic
1169853858 20:10082317-10082339 TCAACTAGGCATATAAAAGGTGG - Intergenic
1171766099 20:29280000-29280022 GCAAATATTCACATAAAAGCCGG - Intergenic
1178688716 21:34732870-34732892 TCAACTAGTGGGTTAAAAGGAGG - Intergenic
1179295363 21:40057324-40057346 TCAAATAATCAAATAAAAGGAGG + Intronic
1179437689 21:41373599-41373621 TCAACAAGTCAGCTAATGGCTGG - Intronic
1182744139 22:32592597-32592619 TCAACTAGTAAGAGGAAACCTGG - Intronic
1184632959 22:45800003-45800025 TAAAATAGCCACATAAAAGCTGG + Intronic
951772067 3:26269604-26269626 TCAACTAGTCAGCAACAAGAAGG - Intergenic
955153713 3:56394697-56394719 TCAAAAAGTCAGATAATAGCAGG + Intronic
955608457 3:60731881-60731903 TCAGCTAGTCAGATATGAGTTGG - Intronic
956223610 3:66931405-66931427 ACAGCCTGTCAGATAAAAGCTGG - Intergenic
959874777 3:111369975-111369997 TCAAATATTCAGAGAGAAGCAGG - Intronic
960270590 3:115669774-115669796 TTAACTTTTCAGATAAGAGCTGG - Intronic
962510397 3:136093727-136093749 TCAAAGAGTCAGATAATAACAGG + Intronic
963020109 3:140864563-140864585 TCAACTAGTCAGGTATCAGCAGG - Intergenic
965495714 3:169396573-169396595 TCTAGTAGTCACATTAAAGCAGG - Intronic
966051564 3:175622509-175622531 TCAAGTACTCAGATAAAGCCAGG - Intronic
969380383 4:6792253-6792275 TCAACTAGTTAAATAAATTCAGG - Intronic
971029646 4:22622281-22622303 TCAAGTAGTCTCATAAAAGCTGG + Intergenic
971282787 4:25255309-25255331 TGAAATATTCAGATATAAGCAGG - Intronic
972200771 4:36712466-36712488 AAAACTAGTCAGAAAAAAACAGG - Intergenic
972456699 4:39262548-39262570 TGAACTATTCAAATAAAAGAGGG - Intronic
973795663 4:54423667-54423689 TCAACTAGTCATATGAATGCTGG - Intergenic
975583269 4:75925801-75925823 TCAACTTGGCAGATAAAGGCTGG - Exonic
977341490 4:95764066-95764088 TGAACTAGTGAGATACCAGCTGG + Intergenic
982552510 4:156820769-156820791 TCAACAACTTAGATAAAAACTGG + Intronic
984623715 4:181981608-181981630 TCATTTAGTCAGGTAGAAGCTGG + Intergenic
986234046 5:5891384-5891406 TCAGCTAGTCAGTGAAATGCTGG - Intergenic
986782854 5:11083344-11083366 TCAACTAGTCAGAAATAGGCAGG + Intronic
990919002 5:60942152-60942174 TCAAACAGTCAAATGAAAGCAGG + Intronic
991244979 5:64501048-64501070 TAAACTGGTAAGATGAAAGCTGG - Intergenic
991338603 5:65579345-65579367 ACAACTTTACAGATAAAAGCTGG - Intronic
995266454 5:110167174-110167196 TCCCCTAGTCACATAGAAGCAGG - Intergenic
996337139 5:122397034-122397056 TGAACTAGTAATATAAAACCTGG - Intronic
997850918 5:137331925-137331947 TCAACAAGTCAGATGAAATCAGG - Intronic
998178455 5:139917076-139917098 TCAAAAAGTCAGATAATAACAGG - Intronic
1002972375 6:2037010-2037032 TGAACTTGTGAGATAAAAGGAGG + Intronic
1003726298 6:8769068-8769090 TAAACAAGGCAGAGAAAAGCAGG - Intergenic
1004351304 6:14892638-14892660 AAAACTAGCCAGATAAAACCAGG + Intergenic
1008802717 6:55389605-55389627 TCAATGAGTCAGAAAAAAGAAGG + Intronic
1010048387 6:71473931-71473953 CCCACTAGTCAGAAATAAGCAGG - Intergenic
1010396385 6:75397056-75397078 TCAACTAGTCAGTTAACATTAGG - Intronic
1011075678 6:83435952-83435974 TCATTTAGACAGATAATAGCTGG + Intergenic
1019205365 6:170357253-170357275 TCAGCTACCCAGATAAAGGCAGG - Intronic
1021584794 7:22196552-22196574 TTAACTTGTCAGTTAAGAGCAGG - Intronic
1022208694 7:28187247-28187269 TCAACTGGACAGAGATAAGCAGG + Intergenic
1022368404 7:29747759-29747781 TCAACTACGGAGATGAAAGCAGG + Intergenic
1024402328 7:48939305-48939327 TCTATTATTCACATAAAAGCTGG - Intergenic
1024516171 7:50259954-50259976 ACAACTAGTCAGAAAATAGCAGG + Intergenic
1031452495 7:121938900-121938922 ACTACTATTGAGATAAAAGCAGG - Intronic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1033849063 7:145472222-145472244 TCAACAAGTCACAAAAAAGTAGG + Intergenic
1034649996 7:152682652-152682674 TCAAGTAGACAAATAGAAGCAGG + Intergenic
1036095006 8:5714076-5714098 GTAGCTAGTCAGATATAAGCAGG - Intergenic
1037601039 8:20394250-20394272 TCTCCTAGACAGATAAAAGCTGG + Intergenic
1039732724 8:40297084-40297106 TTAAAAAGTCAGATAAAGGCTGG - Intergenic
1041029193 8:53718780-53718802 TCAACTAGGCAGAAGAAAGGAGG - Intronic
1044518320 8:93166387-93166409 TCAATTACTCTGATAAAAGAAGG + Intronic
1051041313 9:12815642-12815664 TCAACTAGTCAGATAAAAGCAGG - Intronic
1052253101 9:26423334-26423356 TCAGCTAATTAGAAAAAAGCAGG + Intergenic
1055491642 9:76810902-76810924 TCAACCTGTCATAGAAAAGCAGG - Intronic
1056372314 9:85968777-85968799 CCAACTAGTAATCTAAAAGCTGG + Intronic
1060363768 9:122987272-122987294 TCAATAAGTCAGATGAATGCAGG + Intronic
1186027957 X:5334512-5334534 CCAACTAGTCAGTTAAAACATGG + Intergenic
1186063308 X:5734581-5734603 TTAACTAGTTAGAAAACAGCTGG - Intergenic
1188616944 X:32168987-32169009 TCAACCAATCAGCTCAAAGCAGG - Intronic
1188618579 X:32191388-32191410 TAAACCAGTCAGAGAAAAGTTGG - Intronic
1189103085 X:38211227-38211249 TCAACTAATCATATAAAAACTGG + Intronic
1191141035 X:57117164-57117186 TGAACAAGGCAGAGAAAAGCAGG - Intergenic
1196178092 X:112662312-112662334 TCAACTGGACAGTGAAAAGCGGG + Intronic
1197117963 X:122855413-122855435 TCAACTATCTGGATAAAAGCAGG - Intergenic
1198461646 X:136868717-136868739 TCAACTAGTCAGATATATACAGG + Intronic
1201533501 Y:15018994-15019016 TTAACTAGTTAGAAAACAGCTGG + Intergenic
1202093299 Y:21216790-21216812 TCAACTTTTCTGATTAAAGCTGG + Intergenic
1202304358 Y:23452546-23452568 TCCAAAAGTCAGGTAAAAGCTGG + Intergenic
1202566452 Y:26218045-26218067 TCCAAAAGTCAGGTAAAAGCTGG - Intergenic