ID: 1051045723

View in Genome Browser
Species Human (GRCh38)
Location 9:12871139-12871161
Sequence CTGAAAATACAGAAGTAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051045717_1051045723 11 Left 1051045717 9:12871105-12871127 CCAACCCAGGCAACATGCCAAAA No data
Right 1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG No data
1051045718_1051045723 7 Left 1051045718 9:12871109-12871131 CCCAGGCAACATGCCAAAAGCCC No data
Right 1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG No data
1051045719_1051045723 6 Left 1051045719 9:12871110-12871132 CCAGGCAACATGCCAAAAGCCCG No data
Right 1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG No data
1051045720_1051045723 -6 Left 1051045720 9:12871122-12871144 CCAAAAGCCCGTCTGTACTGAAA No data
Right 1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051045723 Original CRISPR CTGAAAATACAGAAGTAGCT TGG Intergenic
No off target data available for this crispr