ID: 1051045723 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:12871139-12871161 |
Sequence | CTGAAAATACAGAAGTAGCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1051045717_1051045723 | 11 | Left | 1051045717 | 9:12871105-12871127 | CCAACCCAGGCAACATGCCAAAA | No data | ||
Right | 1051045723 | 9:12871139-12871161 | CTGAAAATACAGAAGTAGCTTGG | No data | ||||
1051045718_1051045723 | 7 | Left | 1051045718 | 9:12871109-12871131 | CCCAGGCAACATGCCAAAAGCCC | No data | ||
Right | 1051045723 | 9:12871139-12871161 | CTGAAAATACAGAAGTAGCTTGG | No data | ||||
1051045719_1051045723 | 6 | Left | 1051045719 | 9:12871110-12871132 | CCAGGCAACATGCCAAAAGCCCG | No data | ||
Right | 1051045723 | 9:12871139-12871161 | CTGAAAATACAGAAGTAGCTTGG | No data | ||||
1051045720_1051045723 | -6 | Left | 1051045720 | 9:12871122-12871144 | CCAAAAGCCCGTCTGTACTGAAA | No data | ||
Right | 1051045723 | 9:12871139-12871161 | CTGAAAATACAGAAGTAGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1051045723 | Original CRISPR | CTGAAAATACAGAAGTAGCT TGG | Intergenic | ||
No off target data available for this crispr |