ID: 1051049011

View in Genome Browser
Species Human (GRCh38)
Location 9:12909402-12909424
Sequence GGGTGGCATCAGCTGGTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051049009_1051049011 -8 Left 1051049009 9:12909387-12909409 CCAGTTTATCAATCTGGGTGGCA 0: 6
1: 11
2: 90
3: 215
4: 480
Right 1051049011 9:12909402-12909424 GGGTGGCATCAGCTGGTGCACGG No data
1051049005_1051049011 1 Left 1051049005 9:12909378-12909400 CCAGATGAGCCAGTTTATCAATC 0: 13
1: 45
2: 91
3: 93
4: 161
Right 1051049011 9:12909402-12909424 GGGTGGCATCAGCTGGTGCACGG No data
1051049003_1051049011 22 Left 1051049003 9:12909357-12909379 CCTGAGGTGGGGACCACAAGACC No data
Right 1051049011 9:12909402-12909424 GGGTGGCATCAGCTGGTGCACGG No data
1051049004_1051049011 9 Left 1051049004 9:12909370-12909392 CCACAAGACCAGATGAGCCAGTT 0: 56
1: 337
2: 323
3: 200
4: 256
Right 1051049011 9:12909402-12909424 GGGTGGCATCAGCTGGTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051049011 Original CRISPR GGGTGGCATCAGCTGGTGCA CGG Intergenic
No off target data available for this crispr