ID: 1051051711 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:12941200-12941222 |
| Sequence | TTAGAAGTAACACAGATTTA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1051051711_1051051715 | 29 | Left | 1051051711 | 9:12941200-12941222 | CCCTAAATCTGTGTTACTTCTAA | No data | ||
| Right | 1051051715 | 9:12941252-12941274 | CAATGAAGTCCAATGATCAAGGG | No data | ||||
| 1051051711_1051051713 | 6 | Left | 1051051711 | 9:12941200-12941222 | CCCTAAATCTGTGTTACTTCTAA | No data | ||
| Right | 1051051713 | 9:12941229-12941251 | ACTTTTCTCTCATCTTACAATGG | No data | ||||
| 1051051711_1051051714 | 28 | Left | 1051051711 | 9:12941200-12941222 | CCCTAAATCTGTGTTACTTCTAA | No data | ||
| Right | 1051051714 | 9:12941251-12941273 | GCAATGAAGTCCAATGATCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1051051711 | Original CRISPR | TTAGAAGTAACACAGATTTA GGG (reversed) | Intergenic | ||