ID: 1051051712

View in Genome Browser
Species Human (GRCh38)
Location 9:12941201-12941223
Sequence TTTAGAAGTAACACAGATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051051712_1051051715 28 Left 1051051712 9:12941201-12941223 CCTAAATCTGTGTTACTTCTAAA No data
Right 1051051715 9:12941252-12941274 CAATGAAGTCCAATGATCAAGGG No data
1051051712_1051051714 27 Left 1051051712 9:12941201-12941223 CCTAAATCTGTGTTACTTCTAAA No data
Right 1051051714 9:12941251-12941273 GCAATGAAGTCCAATGATCAAGG No data
1051051712_1051051713 5 Left 1051051712 9:12941201-12941223 CCTAAATCTGTGTTACTTCTAAA No data
Right 1051051713 9:12941229-12941251 ACTTTTCTCTCATCTTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051051712 Original CRISPR TTTAGAAGTAACACAGATTT AGG (reversed) Intergenic