ID: 1051051714

View in Genome Browser
Species Human (GRCh38)
Location 9:12941251-12941273
Sequence GCAATGAAGTCCAATGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051051711_1051051714 28 Left 1051051711 9:12941200-12941222 CCCTAAATCTGTGTTACTTCTAA No data
Right 1051051714 9:12941251-12941273 GCAATGAAGTCCAATGATCAAGG No data
1051051712_1051051714 27 Left 1051051712 9:12941201-12941223 CCTAAATCTGTGTTACTTCTAAA No data
Right 1051051714 9:12941251-12941273 GCAATGAAGTCCAATGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051051714 Original CRISPR GCAATGAAGTCCAATGATCA AGG Intergenic
No off target data available for this crispr