ID: 1051057215

View in Genome Browser
Species Human (GRCh38)
Location 9:13001774-13001796
Sequence TTGAAGACACAGAGGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051057215_1051057226 26 Left 1051057215 9:13001774-13001796 CCTGGCTCCCTCTGTGTCTTCAA No data
Right 1051057226 9:13001823-13001845 TTCAGGGAAGCACTTAGGTTTGG No data
1051057215_1051057218 -3 Left 1051057215 9:13001774-13001796 CCTGGCTCCCTCTGTGTCTTCAA No data
Right 1051057218 9:13001794-13001816 CAATTCCAGCCCCTTTCTCAAGG No data
1051057215_1051057225 21 Left 1051057215 9:13001774-13001796 CCTGGCTCCCTCTGTGTCTTCAA No data
Right 1051057225 9:13001818-13001840 CAATATTCAGGGAAGCACTTAGG No data
1051057215_1051057223 9 Left 1051057215 9:13001774-13001796 CCTGGCTCCCTCTGTGTCTTCAA No data
Right 1051057223 9:13001806-13001828 CTTTCTCAAGGTCAATATTCAGG No data
1051057215_1051057224 10 Left 1051057215 9:13001774-13001796 CCTGGCTCCCTCTGTGTCTTCAA No data
Right 1051057224 9:13001807-13001829 TTTCTCAAGGTCAATATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051057215 Original CRISPR TTGAAGACACAGAGGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr