ID: 1051062392

View in Genome Browser
Species Human (GRCh38)
Location 9:13059360-13059382
Sequence GTTTCTATGTTGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051062392_1051062397 -9 Left 1051062392 9:13059360-13059382 CCAGCCTCCTTCAACATAGAAAC No data
Right 1051062397 9:13059374-13059396 CATAGAAACAAATCCTCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051062392 Original CRISPR GTTTCTATGTTGAAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr