ID: 1051062758

View in Genome Browser
Species Human (GRCh38)
Location 9:13064099-13064121
Sequence CTGAGTGAACAGATGGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051062753_1051062758 11 Left 1051062753 9:13064065-13064087 CCTAGCTATAGTCCTGGGAAATA No data
Right 1051062758 9:13064099-13064121 CTGAGTGAACAGATGGTGTAGGG No data
1051062752_1051062758 12 Left 1051062752 9:13064064-13064086 CCCTAGCTATAGTCCTGGGAAAT No data
Right 1051062758 9:13064099-13064121 CTGAGTGAACAGATGGTGTAGGG No data
1051062755_1051062758 -1 Left 1051062755 9:13064077-13064099 CCTGGGAAATATGGTATTAATAC No data
Right 1051062758 9:13064099-13064121 CTGAGTGAACAGATGGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051062758 Original CRISPR CTGAGTGAACAGATGGTGTA GGG Intergenic
No off target data available for this crispr