ID: 1051067448

View in Genome Browser
Species Human (GRCh38)
Location 9:13121772-13121794
Sequence ATTGAGCTGCAGAAGAAGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051067448_1051067452 13 Left 1051067448 9:13121772-13121794 CCCGGCTTCTTCTGCAGCTCAAT 0: 1
1: 0
2: 2
3: 29
4: 227
Right 1051067452 9:13121808-13121830 CACACTTCCTCCTCTTTGTATGG 0: 1
1: 0
2: 0
3: 24
4: 250
1051067448_1051067453 14 Left 1051067448 9:13121772-13121794 CCCGGCTTCTTCTGCAGCTCAAT 0: 1
1: 0
2: 2
3: 29
4: 227
Right 1051067453 9:13121809-13121831 ACACTTCCTCCTCTTTGTATGGG 0: 1
1: 0
2: 1
3: 21
4: 221
1051067448_1051067454 15 Left 1051067448 9:13121772-13121794 CCCGGCTTCTTCTGCAGCTCAAT 0: 1
1: 0
2: 2
3: 29
4: 227
Right 1051067454 9:13121810-13121832 CACTTCCTCCTCTTTGTATGGGG 0: 1
1: 0
2: 0
3: 17
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051067448 Original CRISPR ATTGAGCTGCAGAAGAAGCC GGG (reversed) Exonic
902718699 1:18290232-18290254 CCTGTGCTGCAGAAGCAGCCAGG + Intronic
903741754 1:25562518-25562540 ATGGAGCTGCAGAAGCTGCAGGG + Intronic
907764086 1:57391012-57391034 ATTCAGCTACAGAAAAAGCATGG - Intronic
907932674 1:59015173-59015195 ATTGAGTGGCAGAGCAAGCCTGG - Intergenic
912457900 1:109810973-109810995 AGTGTGCTGAAGAAGAACCCTGG - Intergenic
912487850 1:110043232-110043254 ATTGAGCAGCAGCAGAAACGGGG + Exonic
912800514 1:112716987-112717009 ATAGAGCAGCAAAAGAAGACGGG + Intergenic
913492316 1:119392403-119392425 AATGGGCTTCAGAAGAAGCATGG - Intronic
916599417 1:166277252-166277274 ATTGAGCTGCATAGGAGGCCTGG + Intergenic
917689028 1:177448557-177448579 ATGGAGCTGCAGATGATGCCAGG + Intergenic
919896434 1:202012376-202012398 ATTGAGCTGCTGGAGAAGGATGG + Exonic
920141436 1:203817640-203817662 ATAGAGCTGCAAAAGAATCAAGG - Intronic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920690542 1:208143204-208143226 TTTAAGCTGAAGAAGATGCCTGG - Intronic
921410142 1:214826971-214826993 ATTGCGTTGCAGAAGAAAACTGG - Intergenic
922622498 1:227000850-227000872 ATTGAACAGCAAAAGGAGCCTGG + Intronic
922750361 1:228067384-228067406 TTTGGGCAGCAGAAGAAGACAGG - Intergenic
922881475 1:228984642-228984664 ATTGGGCTGCTGCAGAAGCAGGG + Intergenic
1063196390 10:3747508-3747530 ATAGAGCTGGAAATGAAGCCAGG - Intergenic
1064673056 10:17735254-17735276 AGTGAGCTGCAGAACAAAACAGG - Intergenic
1064946931 10:20801036-20801058 GATGAGCTGAAGAAGAAGTCTGG - Intronic
1065917914 10:30367814-30367836 AAGGAGCTGCAGGAGAAGCTGGG - Intronic
1068293017 10:55030434-55030456 AATGAGCTGCAAAAGATTCCTGG + Intronic
1069961098 10:72079954-72079976 TCTGAGCTGCAGAAGAACCCAGG + Intronic
1072668219 10:97409953-97409975 ATTTAGCTGCAGAAGGGGCTGGG + Intronic
1073131352 10:101191026-101191048 AGTGAGGTGCAGAAGATGCCGGG - Intergenic
1073910348 10:108335375-108335397 ATTGAGCTGGAGAAAAACACAGG + Intergenic
1074672303 10:115805654-115805676 CTTCAGCTGTAGAAGAAACCAGG + Intronic
1074761611 10:116670688-116670710 ATTGAACTGCAAATGAAGGCTGG + Intergenic
1075292198 10:121240307-121240329 AATGAGCTGCAGAATAAGAGGGG - Intergenic
1075515040 10:123101965-123101987 AGTGGGCGGCAGCAGAAGCCTGG - Intergenic
1076235145 10:128858273-128858295 AAGGTGCTGCTGAAGAAGCCAGG + Intergenic
1076607644 10:131700010-131700032 TTTGAGCTGCAGAGGGAGCATGG - Intergenic
1077056790 11:597786-597808 ATTGAGGGGCAGGTGAAGCCTGG + Intronic
1078171566 11:8932654-8932676 GTTGAGCTGCTGAATACGCCAGG - Intronic
1080778772 11:35411133-35411155 ATTGAGTTCCAGAAAAATCCTGG + Intronic
1081848215 11:46256417-46256439 ACTGAGCTGCAGAACCAGCCTGG - Intergenic
1084269902 11:68023166-68023188 CTTAAGCTGCAGAGGCAGCCTGG + Intronic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1088385420 11:109249072-109249094 ATTGAGCTTCAGAGGAACCTAGG - Intergenic
1089016286 11:115168042-115168064 ACTGGATTGCAGAAGAAGCCAGG - Intergenic
1089523610 11:119082175-119082197 ACTGAGCTCCAGGAGCAGCCTGG + Intergenic
1090205285 11:124880406-124880428 CTTGTGCTGCAGAAGAGGCCTGG + Exonic
1090643973 11:128752443-128752465 AATGAGCAGCAGATGAAGCTTGG + Intronic
1090748114 11:129723387-129723409 ACAGAGCTGCAGAAGAAGCTAGG - Intergenic
1090990700 11:131814737-131814759 ATTAGGCTGCAGACGTAGCCCGG - Intronic
1091123724 11:133078570-133078592 ATTGAGCAGGGGTAGAAGCCAGG - Intronic
1092020081 12:5194527-5194549 GATGAGCTGGAGAAGAGGCCAGG - Intergenic
1092463688 12:8709449-8709471 ATTGAGGGGCAGAAGCAGGCAGG + Intronic
1093576302 12:20734200-20734222 ATTTAGCAGCAGATGAAACCAGG - Intronic
1093785044 12:23183140-23183162 ATCCAGCTGCAAAAGAAGCTGGG + Intergenic
1095838849 12:46669797-46669819 TTTGAGCTGCAGCTGGAGCCAGG + Intergenic
1096420436 12:51452630-51452652 GTTCACCTGCAGAAGAAGTCTGG - Intronic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098693621 12:73522803-73522825 TATGAGATGCAGAAGAAGACAGG + Intergenic
1099657748 12:85516831-85516853 GTTGAGCTGCATAGAAAGCCAGG - Intergenic
1100340092 12:93670498-93670520 ATTAAGATGCAGCAGAGGCCAGG + Intergenic
1101942430 12:109109916-109109938 AATGAGCTGCTGCAGAAGTCTGG + Exonic
1102880701 12:116482532-116482554 AGCGAGCTGCGGAGGAAGCCAGG + Intergenic
1103342801 12:120230079-120230101 ATTGGCCTGCAGAAGAAGGTGGG - Intronic
1104094155 12:125541287-125541309 CTTGAGTTTCAGAAGGAGCCAGG + Intronic
1104492097 12:129203192-129203214 AGTGAGGTGCAGATGCAGCCGGG - Intronic
1104999575 12:132681172-132681194 TTTGAGCGGCTGAAGGAGCCTGG - Exonic
1106544030 13:30715053-30715075 ATTGACCTGGAGAAGGAGCAAGG - Intronic
1111969216 13:94893305-94893327 ATCTAGCTGCAAAAGAAGCTGGG + Intergenic
1112717124 13:102199853-102199875 TTTGAGGTGCAGAAGAAGATGGG - Intronic
1113969836 13:114180443-114180465 GTTGAGCTGGGGAAGGAGCCGGG - Intergenic
1115802255 14:37008241-37008263 ATTTAGATTAAGAAGAAGCCTGG - Intronic
1116621742 14:47212933-47212955 ATTGAGCTTCAGAAGCAACCGGG - Intronic
1117933464 14:60873243-60873265 ATTGACCTACTGAAGAAACCAGG + Intronic
1118035902 14:61865440-61865462 CTTGAGCTGCTGATGAGGCCTGG - Intergenic
1118182689 14:63508874-63508896 CTTAAGGTCCAGAAGAAGCCAGG + Intronic
1119222315 14:72918951-72918973 ATTCAAATGCAGAAGAAACCAGG + Intergenic
1119806320 14:77484720-77484742 CTGGAGCTGCAGAAGCTGCCGGG - Exonic
1120436615 14:84490300-84490322 ATTTAACTGCAAAAGAAGCAAGG - Intergenic
1120924160 14:89781575-89781597 ATGGTGGTGGAGAAGAAGCCAGG + Intergenic
1121348649 14:93155142-93155164 GCTGAGCTGCAGAAGCAGCTTGG - Intergenic
1122718671 14:103709958-103709980 ATGGAGCTGCCGCAGCAGCCTGG - Intronic
1123473130 15:20569384-20569406 AAGGAGCTGCAGGAGAAGCTAGG + Intergenic
1123644876 15:22430969-22430991 AAGGAGCTGCAGGAGAAGCTAGG - Intergenic
1123733431 15:23164395-23164417 AAGGAGCTGCAGGAGAAGCTAGG + Intergenic
1123751560 15:23361766-23361788 AAGGAGCTGCAGGAGAAGCTAGG + Exonic
1124283933 15:28385691-28385713 AAGGAGCTGCAGGAGAAGCTAGG + Exonic
1124298765 15:28525923-28525945 AAGGAGCTGCAGGAGAAGCTAGG - Exonic
1124797035 15:32791864-32791886 ATTGAATTGCAGATGAAGGCTGG + Intronic
1124959232 15:34382465-34382487 AAGGAGCTGCAGGAGAAGCTGGG - Exonic
1124975858 15:34528686-34528708 AAGGAGCTGCAGGAGAAGCTGGG - Exonic
1125228149 15:37419493-37419515 AATGTGCTGGAGAAGGAGCCTGG - Intergenic
1125482553 15:40090706-40090728 AGTGGGATACAGAAGAAGCCAGG - Exonic
1126812537 15:52422434-52422456 ATTGAGATGTAGAAGATGGCAGG - Intronic
1128159142 15:65411545-65411567 ATTGAGCAGCAGGGGAAGACAGG - Intronic
1128352728 15:66901875-66901897 CTTGAGCTGCAGAAGGAAGCAGG - Intergenic
1128357875 15:66941175-66941197 AATGAGCTGCAGTCGAATCCGGG - Intergenic
1128858054 15:71037511-71037533 CCTGAGATGCAGAAGAACCCAGG + Intronic
1129168400 15:73792775-73792797 ATTCAGATGCAGAAGAGGACAGG - Intergenic
1129839576 15:78735437-78735459 AAGGAGCTGAAGGAGAAGCCAGG + Intergenic
1131188068 15:90292440-90292462 AAGGAGCTGCAGGAGAAGCTGGG + Intronic
1132329824 15:101004499-101004521 GTTGAGCTGCAGAGGCAGCCAGG + Intronic
1132590594 16:724735-724757 CTTGAGCTGCAGCTGCAGCCGGG + Exonic
1132867984 16:2103282-2103304 GTTGAGCTGCAGATGCAGCCCGG + Exonic
1133893939 16:9907807-9907829 ATGGAGCTGCAGAGGAAGTGAGG - Intronic
1134523785 16:14929832-14929854 GTTGAGCTGCAGATGCAGCACGG - Intronic
1134549117 16:15131103-15131125 GTTGAGCTGCAGATGCAGCACGG + Intronic
1134711376 16:16328317-16328339 GTTGAGCTGCAGATGCAGCACGG - Intergenic
1134719226 16:16371620-16371642 GTTGAGCTGCAGATGCAGCACGG - Intergenic
1134948200 16:18340265-18340287 GTTGAGCTGCAGATGCAGCACGG + Intergenic
1134955453 16:18380376-18380398 GTTGAGCTGCAGATGCAGCACGG + Intergenic
1136607274 16:31344821-31344843 GCTGAGCTACAGAGGAAGCCAGG - Intergenic
1141277406 16:82601221-82601243 ATTGAGCTGCAGGGGAGGCTGGG - Intergenic
1142069022 16:88079492-88079514 ATTGCCCTGCAGAAAAAGGCTGG + Intronic
1142734432 17:1886953-1886975 AGGAAGCTGCAGAAGAGGCCAGG - Intronic
1143976207 17:10831795-10831817 ATGGAGGAGCAGGAGAAGCCTGG + Intronic
1146523571 17:33546832-33546854 GTTGAGCTGCAGGAGGAGCTGGG - Intronic
1147664718 17:42139222-42139244 GTTGAGCTGCCCATGAAGCCTGG - Intronic
1148707450 17:49648183-49648205 ATTGGGCTACAGAGGAAGCTGGG - Intronic
1152512560 17:80800153-80800175 ATTGAGCTGGTGAGGAGGCCAGG - Intronic
1156442826 18:37208717-37208739 ATTGACCTGAAGAAAGAGCCAGG + Intronic
1157490606 18:48121117-48121139 TTTCAGCTGGAGTAGAAGCCTGG - Intronic
1158403718 18:57142995-57143017 AGTGAGCTCCAGAAGAAGCCAGG + Intergenic
1160263295 18:77315980-77316002 ATTGAAATGCTGAAGAAGCTTGG - Intergenic
1160849443 19:1183412-1183434 ATTGAGCTACAGAAAATGCGAGG + Intronic
1162450354 19:10750592-10750614 ATTGTGCTGCTGATGCAGCCTGG + Intronic
1162458096 19:10797967-10797989 TTGGTGCTGCAGATGAAGCCTGG + Intronic
1162566723 19:11448758-11448780 ATTGAGGGGGAGCAGAAGCCAGG + Intronic
1162791569 19:13065731-13065753 ATGGAGCGGCAGAAGAAGCCAGG - Intronic
1163014176 19:14443556-14443578 ATTGAGCTGAAGGTGAAGCAGGG + Exonic
1165087925 19:33364275-33364297 ACTGAGGTGCAGAAGAAACTGGG - Intergenic
1167740855 19:51324186-51324208 ATTGATCTACAGAACAAGGCAGG + Intronic
925321846 2:2976414-2976436 ATTATGCTGCAGAAGAAGGCAGG + Intergenic
925910749 2:8572055-8572077 ACTGAGCTGCAGACTAGGCCGGG + Intergenic
926541523 2:14185845-14185867 ATTTAGCTGCAAAAGAGGCCAGG - Intergenic
927011002 2:18904190-18904212 ATGGACCTGCAGAGGAAGCATGG - Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
935465160 2:103388289-103388311 AATGAGCTGGAGAAGCAGGCAGG - Intergenic
938682780 2:133709231-133709253 ATTTAGCTGCAAGAGAAGCATGG - Intergenic
938804985 2:134797760-134797782 ATTTAGCTGCGGTAGCAGCCTGG - Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
942496294 2:176543145-176543167 ACTGAGCTGCACATGAACCCAGG - Intergenic
943317251 2:186405392-186405414 ATTCAGCTGCAGAGGAAGTATGG - Intergenic
944047967 2:195435489-195435511 AGTAAACTGCACAAGAAGCCAGG - Intergenic
944089588 2:195891064-195891086 AGTGGGCAGCAGAATAAGCCAGG + Intronic
946406385 2:219494096-219494118 GAGGAGCTGCAGAAGAAACCAGG + Intronic
948439278 2:237976194-237976216 CTTGTGCTGCAGATGGAGCCCGG - Intronic
1169020797 20:2329439-2329461 AATGACCTGCAGAGGAAGACTGG - Intronic
1169136310 20:3199929-3199951 AGGGAGCTGCATAAGAAGCAAGG + Intronic
1169152804 20:3303909-3303931 ATGGAGCTGGAGAGGAAGTCTGG + Intronic
1169933242 20:10856365-10856387 ATAGAGCTGGAGGAGAAGGCTGG + Intergenic
1171179347 20:23081199-23081221 GTTCAGCAGCAGAACAAGCCAGG - Exonic
1173012216 20:39192537-39192559 ATTGAGCCCCAGAAGAAGTTTGG + Intergenic
1176907844 21:14525415-14525437 ATTGATTTGCTGAAGAAGCTGGG - Intronic
1178795493 21:35740301-35740323 AATGAGCTCCACAGGAAGCCTGG + Intronic
1181490951 22:23260534-23260556 GTTTGGCTGCAGCAGAAGCCAGG + Intronic
1182125854 22:27815464-27815486 ATAGAGTTGCAGGAGAAGCAGGG + Intergenic
1182290814 22:29278127-29278149 ACTGAGCTGCATAGGAGGCCTGG - Exonic
1182620181 22:31614548-31614570 TTTGACCTGCAGAACAACCCTGG - Intronic
1183529364 22:38344683-38344705 TGTGGGCTGCAGAAGACGCCTGG + Intronic
1184175445 22:42786310-42786332 AAGGAGCTGCAGGAGAAGCTGGG + Intergenic
1185313974 22:50170843-50170865 CTTCAGCTGCAGAAGCAGCGCGG - Exonic
949732457 3:7129722-7129744 ACAGCGCTGCAGAAGTAGCCTGG + Intronic
949948265 3:9207597-9207619 ATTGAGCTGAGCAAGAAGCCAGG + Intronic
950351505 3:12358206-12358228 GTAGATTTGCAGAAGAAGCCAGG - Intronic
950968552 3:17163980-17164002 AATCAGCTGCAGTAGAAGGCAGG - Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
954304210 3:49716978-49717000 AGTGAGATGCATATGAAGCCAGG + Exonic
954945953 3:54424604-54424626 GCTGAGCTGCAGATGGAGCCAGG + Intronic
955467839 3:59254816-59254838 TTTGTTCTGCAGAAGAAGACAGG - Intergenic
956446453 3:69330790-69330812 ATTCAGCGGCAAAAGAGGCCGGG - Intronic
958033853 3:88148081-88148103 AGTGAGCCGCAGGAGAAGCATGG - Intronic
959023663 3:101215946-101215968 TTTGTGGTGCAGAAGAAGGCAGG - Intergenic
960260500 3:115562810-115562832 ATCGAACTGCAAGAGAAGCCAGG + Intergenic
960886196 3:122397618-122397640 ATTGTGGTGCAGATGAGGCCAGG - Intronic
961140699 3:124553461-124553483 ACTGAGCTTCAGAGGAAACCAGG - Intronic
961442442 3:126960987-126961009 ACTGAGCGACAGAAGAGGCCAGG + Intergenic
961580202 3:127874724-127874746 CTTCATCTGCAGAGGAAGCCAGG + Intergenic
961951011 3:130749080-130749102 ATTGAGATGGAGAAGAAGGGAGG - Intergenic
966922827 3:184625314-184625336 TTTTAGCTGCAAAAGAAGCTGGG - Intronic
967645243 3:191914972-191914994 ATTAAGCTGCGGAGGAAGCCCGG - Intergenic
967648294 3:191953054-191953076 ATTGACCTGCTGAAGACACCAGG - Intergenic
968007963 3:195255846-195255868 ATTTAGCTGCAGAAGAGGTCTGG - Intronic
968518684 4:1025412-1025434 ACGGAGCTGCAGACGAAGGCAGG + Exonic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
969125388 4:4944065-4944087 ACTGAGCTTCAGAAGCAGCCTGG + Intergenic
969241949 4:5904785-5904807 ATAGAGCTGCTGAAGAAGCTTGG - Intronic
970660789 4:18283266-18283288 ACTTAGCTGCAAGAGAAGCCTGG + Intergenic
971376789 4:26062026-26062048 CTGGAGCTGAACAAGAAGCCAGG + Intergenic
972297605 4:37755055-37755077 ATTTTGCTGAACAAGAAGCCAGG - Intergenic
976255965 4:83101082-83101104 ACAAAGCTGCAGAAGAAGCTGGG + Intronic
976359787 4:84164201-84164223 ATACAGCTGGAGAATAAGCCAGG - Intergenic
976569785 4:86594624-86594646 AAGGAGCTGTAGAAGGAGCCTGG - Exonic
980182909 4:129423830-129423852 AATGAACTGGAGAAGAAGTCAGG - Intergenic
982109425 4:152040299-152040321 ATTAGGATGGAGAAGAAGCCTGG + Intergenic
985890268 5:2709973-2709995 CTTCAGATGCAAAAGAAGCCTGG - Intergenic
986044008 5:4020344-4020366 ATGGAGCTGCTTCAGAAGCCAGG - Intergenic
987173648 5:15284883-15284905 AGTCAGAGGCAGAAGAAGCCAGG - Intergenic
988847821 5:35146866-35146888 AATGAGCTGGAGAAGATGCAAGG + Intronic
989112614 5:37921326-37921348 ATTATGGAGCAGAAGAAGCCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994001716 5:94789009-94789031 TTTGAGCTGCAGTTGAACCCTGG - Intronic
994157908 5:96523906-96523928 AATTAGCTGCAAAAGAAGCTGGG + Intergenic
995746240 5:115406995-115407017 GTAGTGCTGCAGAAGAGGCCAGG - Intergenic
995956452 5:117782706-117782728 ATTGAGCTGCTGGAGCAGGCAGG + Intergenic
997753815 5:136375535-136375557 ATTGGGCAGCAGAAGAAGGCAGG - Intronic
999141886 5:149367821-149367843 ATGCGGCTGCAGAAGAAGCAAGG - Intronic
999405568 5:151303830-151303852 AATGAGCTGCAGCAGAATCCTGG + Intergenic
1000120079 5:158189008-158189030 AATGAGCTGCTGCAGAAGTCAGG - Intergenic
1000682830 5:164207792-164207814 ACTGAGCTGCTGAAGCAACCTGG - Intergenic
1010301828 6:74269646-74269668 ATTTAGCTGCAGCTGTAGCCTGG - Intergenic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011221879 6:85063404-85063426 ATTGAGCTGCAGAGAAAGCAGGG - Intergenic
1012776927 6:103508263-103508285 ATTGAGCTTCAGATAAAACCAGG + Intergenic
1014425394 6:121298660-121298682 ATTGAGCAGCAGAAGAAGAGAGG - Intronic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015127832 6:129773966-129773988 ATTGATCTGTAGGAGAAGACAGG - Intergenic
1015655016 6:135508143-135508165 ATTAAGATGCAGAAGAGGGCGGG - Intergenic
1015714748 6:136180917-136180939 GTGGAGCTACAGAAGGAGCCAGG + Intronic
1018855352 6:167670529-167670551 ATCAAGCGGCAGGAGAAGCCAGG + Intergenic
1019493100 7:1324171-1324193 CTTGGGCTGCAGACGAATCCAGG - Intergenic
1019908223 7:4081005-4081027 ATCCATCTGCAGAAGTAGCCAGG + Intronic
1022903693 7:34835182-34835204 ATAGGTCTGCAGAAGAAGACTGG + Intronic
1025142592 7:56478518-56478540 GATGAGCTGCAGAAGGAGCAGGG + Intergenic
1025610806 7:63074056-63074078 GATGAGCTGCAGAAGGAGCAGGG - Intergenic
1025708653 7:63889119-63889141 GATGAGCTGCAGAAGGAGCAGGG + Intergenic
1027026052 7:74852309-74852331 ATTGAGCTGGAGAAGACTGCAGG - Intergenic
1027061704 7:75091801-75091823 ATTGAGCTGGAGAAGACTGCAGG + Intergenic
1027345775 7:77258047-77258069 ATAGAGCTGGGGAAGAAGCTGGG + Intronic
1027856984 7:83524286-83524308 ATTTATCTGCTGAAGAAGACTGG - Intronic
1028141023 7:87274768-87274790 ATTAGGCTTCAGAAGTAGCCAGG + Intergenic
1032101897 7:128986855-128986877 CTTTGGCTGCAGCAGAAGCCAGG + Exonic
1032303720 7:130713291-130713313 ATTGATGTGCAGAAGAATGCTGG - Intergenic
1037789539 8:21924991-21925013 ATTGAGCATCACAACAAGCCTGG + Intronic
1039376297 8:37037520-37037542 GTAGAGCTGCAGAAGCAGCATGG + Intergenic
1039834657 8:41246900-41246922 AGTGAGGTGCAGAAGCAGCAGGG - Intergenic
1041678908 8:60566263-60566285 AATGAGCTGCAGTAGAAGCAAGG - Intronic
1041691333 8:60690864-60690886 ACTGAGCTGCAGAAAATGACAGG - Intronic
1043015982 8:74940921-74940943 AATAAGCAGCAGAAGTAGCCAGG - Intergenic
1044827656 8:96213749-96213771 ATTGAGCGTCAGCAGAAGGCAGG - Intergenic
1049173826 8:141179189-141179211 CTTGAGCTGCAGCAGCAGCCGGG + Intronic
1049784805 8:144445209-144445231 CTTCAGCTGCAGAAGTAGCCCGG + Intergenic
1051067448 9:13121772-13121794 ATTGAGCTGCAGAAGAAGCCGGG - Exonic
1051718176 9:20007783-20007805 CTTGTGCTGCAGAAGAGGACAGG - Intergenic
1053466334 9:38311387-38311409 ATTGAGCAGAAGAGGAAGACAGG - Intergenic
1053653695 9:40194649-40194671 GTTGAACAGCAGAAGAAGCCAGG + Intergenic
1053904079 9:42823808-42823830 GTTGAACAGCAGAAGAAGCCAGG + Intergenic
1054530906 9:66181705-66181727 GTTGAACAGCAGAAGAAGCCAGG - Intergenic
1055565471 9:77564263-77564285 ATTGATCTGCAGAAAAGTCCAGG + Intronic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1058425657 9:104873720-104873742 AGTGAGCTTAAGAACAAGCCTGG + Intronic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1060372406 9:123086760-123086782 ACTGAGCTGGTGAAGAAGTCAGG + Intronic
1060492266 9:124093600-124093622 ATGAAGCTGCAGAAGAAGCGAGG + Intergenic
1060781762 9:126418227-126418249 GTTGAGTTGCAGAGCAAGCCAGG + Intronic
1185807470 X:3071897-3071919 CTTGAGCTTCAGGAGATGCCTGG + Intronic
1187001809 X:15188358-15188380 ATTGACCTGCTGAAGAAACCAGG - Intergenic
1188389441 X:29601523-29601545 ATTGTGCTGCTGTAGAAACCTGG + Intronic
1188932541 X:36130537-36130559 ATTGAGCTGCAGTTTAATCCAGG + Intronic
1190561774 X:51693584-51693606 ATTAAGCAGCAAAACAAGCCAGG - Intergenic
1192576697 X:72248481-72248503 ATGGAGCTGTCCAAGAAGCCAGG + Intronic
1194985558 X:100486037-100486059 ATTGGGCTGCAGCAGCTGCCAGG - Intergenic
1202604595 Y:26627947-26627969 ATTGAGCTTCAGAAGACAACTGG - Intergenic