ID: 1051071654

View in Genome Browser
Species Human (GRCh38)
Location 9:13175699-13175721
Sequence TCCTCAACCCCCTTGACAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051071654_1051071658 -9 Left 1051071654 9:13175699-13175721 CCCCTTGTCAAGGGGGTTGAGGA 0: 1
1: 0
2: 0
3: 13
4: 124
Right 1051071658 9:13175713-13175735 GGTTGAGGAGTAGGTATATGAGG 0: 1
1: 0
2: 1
3: 12
4: 148
1051071654_1051071659 12 Left 1051071654 9:13175699-13175721 CCCCTTGTCAAGGGGGTTGAGGA 0: 1
1: 0
2: 0
3: 13
4: 124
Right 1051071659 9:13175734-13175756 GGAAAATGAGAAACTTACCTAGG 0: 1
1: 0
2: 4
3: 37
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051071654 Original CRISPR TCCTCAACCCCCTTGACAAG GGG (reversed) Intronic