ID: 1051072146

View in Genome Browser
Species Human (GRCh38)
Location 9:13183417-13183439
Sequence CCTTAGGAGGAGATGATGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051072140_1051072146 9 Left 1051072140 9:13183385-13183407 CCTATAAAAGAAAAATTGGCTTT 0: 1
1: 0
2: 3
3: 47
4: 654
Right 1051072146 9:13183417-13183439 CCTTAGGAGGAGATGATGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051072146 Original CRISPR CCTTAGGAGGAGATGATGGA AGG Exonic
900848909 1:5126563-5126585 CCTTAGGAGCAGTTTAGGGAGGG - Intergenic
901754596 1:11433940-11433962 CCTTCAGAGGAGATGATCAATGG + Intergenic
902675331 1:18004781-18004803 ACATAGGAGGAGGTGATGGAGGG + Intergenic
904513422 1:31033607-31033629 CTTTAGGAGGCCATGCTGGATGG - Intronic
905564539 1:38953375-38953397 CCTTAGGAGCAGTTTAGGGAAGG - Intergenic
905973254 1:42156427-42156449 CTTTAGGAGGCCATGATGGGAGG + Intergenic
910482531 1:87674226-87674248 CCTTGGGAGGAGTAGATGAAAGG + Intergenic
912739910 1:112184691-112184713 TGTTAGGAGAAGAAGATGGAGGG + Intergenic
913500833 1:119471269-119471291 CCTGAGGAGGAGATGGAGCAAGG + Intergenic
913511651 1:119568063-119568085 CCTGGGGAGGAGATGAAGCAAGG + Intergenic
913515881 1:119605388-119605410 CCTGGGGAGGAGATGAAGCAAGG + Intergenic
914353141 1:146857465-146857487 CCTTAGGAGGACATGTGGGCAGG + Intergenic
914831422 1:151173615-151173637 CCTGATGGGGAGATGAAGGATGG + Exonic
915259576 1:154666856-154666878 TCTCAGGAGGAGATCATGGGTGG - Intergenic
915358052 1:155268445-155268467 CCTGGGGTGGAGATGAAGGAAGG + Intronic
917123128 1:171661697-171661719 CCTTAGAAGGAGATGTGGGTAGG + Intergenic
917800290 1:178563477-178563499 TCAGAGGAGGAGATGATGAATGG + Intergenic
918675310 1:187277342-187277364 TCTTAGGAGGAGATCATAGGTGG - Intergenic
920056808 1:203198757-203198779 CCTTATGAGCGGATGATGGAGGG + Intergenic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920725243 1:208428708-208428730 CCGTAGGAGGAGAGGGTGTAAGG + Intergenic
921324560 1:213978039-213978061 TCTAAGGAAGAGAAGATGGAAGG + Intergenic
922370615 1:224907101-224907123 CCTAGGTAGGAGATAATGGATGG + Intronic
922625098 1:227032512-227032534 CCTTAGGAGGACTTGTTGGTAGG - Intronic
923006706 1:230055703-230055725 CCTCAGGAGGAGGTGATTCATGG + Intergenic
923425870 1:233868969-233868991 CCTGAAGATGTGATGATGGATGG - Intergenic
1063159296 10:3408199-3408221 CCTCAGGAGCAGAGGATGCAGGG + Intergenic
1063236235 10:4119296-4119318 CCTTAGGAGGAAGCGATGGATGG - Intergenic
1063320342 10:5046236-5046258 CCATAGGAGGAGGGAATGGAGGG - Intronic
1063757684 10:9033164-9033186 TCTTAGGAGGACAGGATGGCTGG - Intergenic
1063948308 10:11199050-11199072 CCTTAGGAGGAGGGGTTGGTAGG + Intronic
1065495385 10:26322083-26322105 CTTCAGGAGTAGAAGATGGATGG + Intergenic
1068650674 10:59519242-59519264 CCTAAGGCTGAGAAGATGGAGGG - Intergenic
1069582849 10:69577208-69577230 CCTTAGGAGCAGGTGACGGCTGG - Intergenic
1069616387 10:69809019-69809041 CCTTGGGAGTAGAGGATGGGAGG - Intronic
1069688384 10:70333904-70333926 CTTTGGGAGGACATGATGGGTGG + Intronic
1070582015 10:77728266-77728288 ACTTAGGAAGAGTTGATGGGTGG + Intergenic
1071420509 10:85492642-85492664 CCTGAGGAGGGGCTGCTGGAAGG + Intergenic
1072919807 10:99567045-99567067 CTTTGGGAGGACATGATGGGAGG - Intergenic
1074698854 10:116075608-116075630 ACTTAGGAGAAGATGCTGAAGGG - Intronic
1075373710 10:121959951-121959973 CCTTAGGAGGACATGAGTAATGG + Intronic
1075622438 10:123937808-123937830 CCTTTAGAGAAGATGAGGGAAGG + Intronic
1077933239 11:6755047-6755069 CCTTAGGAGGAGGTGTGAGATGG + Intergenic
1080711605 11:34753116-34753138 CCTTATGAGGAGAAGATTGCAGG + Intergenic
1080974230 11:37316931-37316953 CCTTTGGAGAGGATGAAGGATGG - Intergenic
1083129476 11:60611003-60611025 ACTTAGGAGGGGAAGGTGGAAGG + Intergenic
1084181226 11:67447422-67447444 CCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1084303646 11:68267334-68267356 TCTTAGCAGAAGATGATGAAAGG - Intronic
1084308072 11:68299413-68299435 CCTTAGCAGGAGGTGAGGGCGGG + Intergenic
1084518811 11:69650559-69650581 CCTGAGCGGGAGAGGATGGAGGG + Intronic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1087591300 11:100191656-100191678 CAGCAGGAGGATATGATGGAGGG + Intronic
1089712569 11:120325997-120326019 CTTTAGAAGGAGATAAGGGAGGG + Intronic
1090270244 11:125380882-125380904 CTTTAGGGGGTGATGTTGGAGGG + Intronic
1091294700 11:134465496-134465518 CCTTAGGAGGAGATGCTTGGTGG + Intergenic
1091499683 12:1004082-1004104 CCATAACAGGAGATGGTGGAAGG - Intronic
1092654676 12:10672479-10672501 CTTTAGGAGGAGTTGGTGGGTGG - Intronic
1094636364 12:32230289-32230311 CCTTAGGAGGCTGAGATGGAAGG + Intronic
1095666987 12:44814140-44814162 CCTCAGGAGGAGCAGATGGAGGG + Intronic
1097245015 12:57603089-57603111 CCTTTGGAGCAGAAGATGAAGGG - Exonic
1097588494 12:61544231-61544253 ACTGATGAAGAGATGATGGAGGG + Intergenic
1098188515 12:67923760-67923782 GCATAGGAGGAAATGAGGGAAGG - Intergenic
1099112174 12:78575185-78575207 TCTTAGGAGTAGTTTATGGAGGG - Intergenic
1099133274 12:78863513-78863535 CCTGTGGAGCAGATAATGGACGG + Intergenic
1099864340 12:88260312-88260334 CCTTCCCAGGAGATCATGGAGGG - Intergenic
1103555786 12:121765777-121765799 CCTGAGGAGGAGCTGGAGGAGGG - Intronic
1103594162 12:122013548-122013570 CCTTAGGTGTGGATGGTGGATGG - Intergenic
1104320395 12:127745336-127745358 TCTTAGGAGGAGTTTAGGGAGGG + Intergenic
1104326928 12:127808012-127808034 CCTTGCGAGGAGCAGATGGAAGG - Intergenic
1105633310 13:22193452-22193474 CCTCAGGAGGAGGTGAAGAAAGG + Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105959468 13:25317197-25317219 CCTTTTGAGGAAATGATAGAAGG + Intronic
1106474824 13:30089605-30089627 GCTTAGGAGGAGAGGGTTGAGGG - Intergenic
1106717660 13:32407949-32407971 CCTTAGCAGGAGATGGGAGAGGG + Intronic
1107112663 13:36714787-36714809 CCTTGAGAGGAGGAGATGGAAGG + Intergenic
1107238315 13:38199897-38199919 CTTTAGGAAGATATGAGGGAAGG + Intergenic
1107795982 13:44052310-44052332 CATCAGGAAGAGATGAGGGAAGG - Intergenic
1107868642 13:44727651-44727673 TCTTAGGAGGAGTTTAGGGAGGG - Intergenic
1110122905 13:71905362-71905384 CCTTAGGAGGAGAGGAAGAAAGG - Intergenic
1110390340 13:74966126-74966148 CCATAAGAGGAGAACATGGATGG - Intergenic
1112160292 13:96860018-96860040 CCCTAGGAGGAGTGGTTGGATGG - Intergenic
1112617793 13:101022857-101022879 CATGAGGAGGATATGATGAATGG - Intergenic
1113400222 13:109985687-109985709 ACTTCAGAGGAGATGAAGGAAGG - Intergenic
1113792622 13:113037262-113037284 CCCTAGGAGTAGAAGGTGGAGGG + Intronic
1114235737 14:20822029-20822051 TCTTAGGAGGAGTTTAGGGAGGG + Intergenic
1114409807 14:22490036-22490058 CCTCAGGAGCAGAGAATGGAGGG + Intergenic
1114858722 14:26488323-26488345 CCTTAGGAAGAGAGAATGAATGG + Intronic
1118338612 14:64876795-64876817 CCTTTGGAGGAGATTATGAGAGG - Intronic
1119732750 14:76961535-76961557 CATTAGGAGGAAAAGAGGGATGG + Intergenic
1120694803 14:87632833-87632855 TCTTAGGAGCAGTTTATGGAGGG - Intergenic
1121529389 14:94641648-94641670 CCTGAGGAGGAGATCCAGGAAGG + Intergenic
1121817032 14:96936446-96936468 GCTGAGGAGGAGATGAGAGAAGG - Intergenic
1122160864 14:99782774-99782796 CCTGTGAAGGAGATGATGGGAGG + Intronic
1122289251 14:100671046-100671068 CTGTACGATGAGATGATGGATGG + Intergenic
1123043521 14:105500164-105500186 CCTTAGGAGGAGCTGGCGGAGGG - Intergenic
1124486722 15:30123985-30124007 CTTTAGGAGGACAAGATGGAAGG - Intergenic
1124541800 15:30592962-30592984 CTTTAGGAGGACAAGATGGAAGG - Intergenic
1124756807 15:32414338-32414360 CTTTAGGAGGACAAGATGGAAGG + Intergenic
1125690699 15:41593839-41593861 CCTTAGGAGCAGTTTAGGGAGGG + Intergenic
1127309404 15:57739171-57739193 CCCAAGGAGGAAAGGATGGAAGG - Intronic
1127512019 15:59651925-59651947 CTTTAGGAGGACAAGGTGGAAGG - Intronic
1130744464 15:86636049-86636071 ACTGAGGAGGAGATGATTTAGGG - Intronic
1132006853 15:98235144-98235166 CCTCAGGAGGGCATCATGGAAGG - Intergenic
1132573578 16:654853-654875 CTTCAGGATGAGAAGATGGAGGG + Intronic
1132663181 16:1070554-1070576 CCTTTGGAGGAGCGGAGGGAGGG + Intergenic
1133120858 16:3606479-3606501 CCTCAAGAGGAGATGATGGCGGG - Exonic
1139670662 16:68490842-68490864 TATTAGGAGGAGGTGAGGGAGGG + Intergenic
1139980883 16:70858053-70858075 CCTTAGGAGGACATGTGGGCAGG - Intronic
1141335732 16:83153379-83153401 CCTTAGGAGCAGTTTAGGGAGGG + Intronic
1144690438 17:17258966-17258988 CCTAAGGAGAAGAGGAAGGAAGG - Intronic
1146776279 17:35620235-35620257 CCTTAGGAGGCCAAGATGGGAGG + Intronic
1146913893 17:36665790-36665812 CCGGAGGAGGAGATCGTGGATGG + Intergenic
1147424455 17:40339357-40339379 CCTGAGAAGGAGCTGAGGGAGGG + Intronic
1147601824 17:41751325-41751347 CCTTAGGAGGCCAAGGTGGAAGG + Intergenic
1148286419 17:46396953-46396975 CCATAGGATGAGAACATGGAAGG + Intergenic
1148308585 17:46614545-46614567 CCATAGGATGAGAACATGGAAGG + Intronic
1148486814 17:47996123-47996145 CCTTGGGAGCAGATGGTGGGAGG - Intergenic
1148812456 17:50302389-50302411 CCTTGGTAGAAGCTGATGGAGGG + Intergenic
1149335439 17:55630750-55630772 GCTTAAGGGGAGATGAGGGAAGG - Intergenic
1150725555 17:67648738-67648760 CCCTATGTGGAGATGAAGGAGGG + Intronic
1151333077 17:73422611-73422633 CCTGGGGAGGAGACGGTGGAGGG + Intronic
1151629634 17:75301667-75301689 CCACAGCAGGAGATGATGGCGGG + Intergenic
1152393887 17:80020127-80020149 CCTTAGGAGGCTGTGAGGGAGGG - Intronic
1152438244 17:80289028-80289050 TCTTAGGAGGTGGTGAGGGATGG + Intronic
1155705365 18:28803659-28803681 CCTTAAGGAGAGATGATGGGGGG + Intergenic
1155952140 18:31924833-31924855 CCGTATGAGGAGATGTTGGCAGG + Intronic
1157937659 18:51891094-51891116 CCTCATGGGGAGGTGATGGAAGG + Intergenic
1158608261 18:58915418-58915440 CCTTAGGTGGAGTAGAGGGATGG + Intronic
1159052855 18:63437650-63437672 CCTTAGGAGGCCAAGGTGGAAGG - Intergenic
1160568091 18:79798982-79799004 CCTTTGGAGGAGGTGACAGAGGG - Intergenic
1161410110 19:4112386-4112408 CATGAGGAGGAGATGGGGGAGGG + Intronic
1162311425 19:9909704-9909726 GGTTAGGAGGAGATGTCGGAAGG - Intronic
1162776993 19:12985897-12985919 CCTATGGAGGGGAAGATGGAGGG - Intergenic
1163654631 19:18538550-18538572 ACTGAGGAGGGAATGATGGAGGG - Intronic
1163802830 19:19377669-19377691 TCTTAGGGGGTAATGATGGAGGG + Intergenic
1163991666 19:21004270-21004292 CTTTAGGATGGGATGATAGAAGG + Intergenic
1164523723 19:28998413-28998435 CCCTAGCAGGAGAGGAGGGAGGG + Intergenic
1164556404 19:29256038-29256060 ACTGAGGAGGGGATGAAGGAAGG - Intergenic
1164754205 19:30677967-30677989 CCTTGGGAGGAGAAGAGGCAGGG + Intronic
1166146852 19:40843977-40843999 CCTGAGGAGGAGAGGCGGGAGGG + Exonic
1166151013 19:40875874-40875896 CCTGAGGAGGAGAGGCGGGAGGG + Exonic
1166155508 19:40908653-40908675 CCTGAGGAGGAGAGGCGGGAGGG + Intergenic
1166179308 19:41095738-41095760 CCTGAGGAGGAGAGGCAGGAGGG - Exonic
1166808609 19:45501683-45501705 CCTTAGGAGGAGACCCTGAAAGG - Intronic
1168557619 19:57356300-57356322 GCTTCAGAGGGGATGATGGAGGG + Exonic
1168709278 19:58489244-58489266 TCTTAGGAGCAGTTGAGGGAGGG - Intronic
926707039 2:15844235-15844257 CCTCAGGTGGAACTGATGGATGG + Intergenic
927853409 2:26513699-26513721 CCTTCCCAGGAGAGGATGGAGGG + Intronic
928193080 2:29192028-29192050 CCCTAGGAGGCGATGAGGAAAGG - Intergenic
928611004 2:32992767-32992789 CCTCAGGAGGAGATCCTGCAGGG + Intronic
934605959 2:95695296-95695318 CCCAAGGATGAGATGATGAAGGG - Intergenic
934912822 2:98274959-98274981 CCTGAGGAGCAGAGGAAGGATGG - Intronic
935548671 2:104428391-104428413 CTTAAGGAGCAGATGATGTAAGG + Intergenic
935577767 2:104728669-104728691 TCTTATGAGGAGAATATGGACGG - Intergenic
936744850 2:115562549-115562571 TAATAGGAGGAGATGATAGAGGG - Intronic
937316827 2:120937035-120937057 CCTTGGAAGGAGGGGATGGAGGG - Intronic
937922720 2:127143228-127143250 CCTTTGGAGGAGCAGAAGGATGG - Intergenic
939293982 2:140233240-140233262 CCTTAGGAAGTGTTGATGAAAGG - Exonic
940479710 2:154212715-154212737 CCTTAGAAGGAGAAGAAGGATGG - Intronic
941263695 2:163331900-163331922 CCTAAGGAGGAGAGTGTGGACGG + Intergenic
941405705 2:165084595-165084617 GCGGAGGAGGAGATGATGGTGGG + Intergenic
941416296 2:165225540-165225562 CCTTAGGAGGAGATGGAGAGAGG + Intergenic
942832585 2:180254200-180254222 CCTCAGTAGGAGATGATGTGAGG + Intergenic
946034605 2:216731785-216731807 AGTTTGGAGGAGATGATGGAAGG - Intergenic
946310971 2:218882456-218882478 TCTGAGGTGGAGATGCTGGATGG - Intronic
947817133 2:233045140-233045162 TCTGATGAGGAGATGAGGGAAGG - Intergenic
948596594 2:239083311-239083333 CCTTAGGAGGAGCTGAGGGAGGG + Intronic
948861784 2:240756113-240756135 CCTTGGGTGGAGATGGTGGAAGG - Intronic
948933991 2:241150526-241150548 CAGTCGCAGGAGATGATGGAGGG + Exonic
1170717253 20:18842620-18842642 CCTTTGGAAGAGATGCTGGTTGG + Intergenic
1171878258 20:30598154-30598176 CCTTAGGAGGGGAGGAGGGCAGG - Intergenic
1174083409 20:47987154-47987176 CATTAGGAGTAGAGGAAGGAAGG - Intergenic
1175509844 20:59516520-59516542 CCATAGGAGGAGATGCTGCCAGG - Intergenic
1175839349 20:62016893-62016915 CTTTAGGAGGCCAAGATGGAGGG + Intronic
1178377231 21:32076708-32076730 TCTTAGAAGGAGATCACGGAGGG - Intergenic
1181064130 22:20297710-20297732 CCTGATGAGGAGAGGAAGGAGGG + Intergenic
1183310649 22:37107766-37107788 CCTTTGGAGGAGGTAAAGGAGGG - Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183488171 22:38101186-38101208 TTTTAGGAGAAGATGAAGGAAGG - Intronic
1184105890 22:42367446-42367468 CCTTAGGAGGATATCAGAGAGGG - Intergenic
1184122079 22:42458206-42458228 CCTTAGGCAGAGGAGATGGAAGG + Intergenic
1184250919 22:43259873-43259895 CCTGAGGAGAAGAGGCTGGAGGG - Intronic
1184254831 22:43280894-43280916 GCTGAGGAGGAGATGACAGAAGG - Intronic
1184254861 22:43281015-43281037 GCTGAGGAGGAGATGACAGAAGG - Intronic
1184254890 22:43281133-43281155 GCTGAGGAGGAGATGACAGAAGG - Intronic
1184254919 22:43281251-43281273 GCTGAGGAGGAGATGACAGAAGG - Intronic
1184254949 22:43281372-43281394 GCTGAGGAGGAGATGACAGAAGG - Intronic
1185161150 22:49230512-49230534 TCCTAGGAGGAGGTGAAGGAGGG + Intergenic
949372295 3:3348419-3348441 CCTTAGGAGGCCAAGATGGGAGG - Intergenic
950004898 3:9685367-9685389 CCTCAGGAGGAGATGACAGGGGG - Intronic
951967613 3:28404870-28404892 ACTTAGGAGGAAATAATGGAAGG + Intronic
953311827 3:41887918-41887940 CTTTAGGAGGATGAGATGGAAGG + Intronic
955216253 3:56986966-56986988 CCTTGGGAGGCCATGATGGGAGG + Intronic
957725936 3:84067273-84067295 TCTTAGGAGGAGTTTAGGGAGGG + Intergenic
958698133 3:97553317-97553339 CCTTGTGAGGACATGAGGGAAGG - Intronic
959009232 3:101055537-101055559 CCCTAGTAGGAGATGAGGGGAGG + Intergenic
959992887 3:112648092-112648114 CCTGTGGAGGAGGTGATGCAGGG - Intronic
960438617 3:117658839-117658861 CCAGAGAAGGAGATGAGGGAAGG - Intergenic
962732710 3:138298664-138298686 CCTAAGGAGAAGAGGATGGAGGG - Intronic
963907891 3:150788412-150788434 TCTCAGGAGGAGGTGATGGCAGG + Intergenic
963941744 3:151102589-151102611 ACTTAGGAGGCAAAGATGGAAGG - Intronic
964752909 3:160068621-160068643 CCTTGGGAGGCGATTAGGGATGG + Intergenic
965087996 3:164124407-164124429 CCTTAGGAGTAGTTTAGGGAGGG + Intergenic
965342548 3:167508001-167508023 CCTTAGTAGGTGATGCAGGAAGG + Intronic
967101643 3:186220921-186220943 CCTTAGGAGGAGATACTGTCAGG - Intronic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
968923734 4:3536147-3536169 CCTGTGGAGGTGATTATGGAGGG + Intergenic
969717906 4:8877336-8877358 CCTGAGGAGGAGGAGATGGGAGG + Intergenic
969849202 4:9943273-9943295 CCTTAGATGGAGATGATGATTGG - Intronic
971045022 4:22796514-22796536 CTTTAGGAGGTGATGAAGGTAGG + Intergenic
971228952 4:24782104-24782126 CCTTAGGAGGAAGAGAAGGATGG - Intergenic
971409000 4:26350623-26350645 CATTAAGAGGTGAGGATGGAGGG + Intronic
972260878 4:37407365-37407387 CCCAAGGAGGAGATCTTGGAGGG + Intronic
972442422 4:39107599-39107621 CCGTAGGAGGACATGATGGCTGG + Exonic
972469457 4:39389713-39389735 CTTTAGGAGGTGGAGATGGAAGG - Intergenic
972730506 4:41789999-41790021 CTTAAGGAGGAGAAGAAGGAAGG - Intergenic
973803171 4:54498356-54498378 CCATAGGAAGGGATGCTGGAGGG + Intergenic
973925193 4:55729885-55729907 CCTTAGGAAAAGGTGAGGGAGGG - Intergenic
975210096 4:71689957-71689979 ACATAGGAAGAGATGCTGGATGG - Intergenic
976057520 4:81085561-81085583 GATTAGGAGGAGAGAATGGAAGG - Intergenic
976127276 4:81847448-81847470 CCTGAGGAGGAGATGTGGGCAGG - Intronic
978942944 4:114459358-114459380 CCTTAAGTGGAGATCAGGGATGG - Intergenic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
980382951 4:132049080-132049102 CCTTGGGAGGAAATAATGTAAGG - Intergenic
982672104 4:158333363-158333385 CATGGGTAGGAGATGATGGAAGG - Intronic
990118637 5:52421625-52421647 CCATTAGAAGAGATGATGGAAGG + Intergenic
991066283 5:62428271-62428293 CTTTAGGAGGCCAAGATGGAAGG - Intronic
993422755 5:87721799-87721821 TCTTAGGAGCAGTTTATGGAGGG + Intergenic
997074205 5:130652783-130652805 CCTTAGGCTGAGATGAAGGGAGG - Intergenic
997497638 5:134343591-134343613 TCTTAGGAGCAGTTTATGGAGGG - Intronic
999445866 5:151638971-151638993 CATTAGGAGGTGCTGATGGCAGG - Intergenic
1000253078 5:159513605-159513627 CCTTAGGAAGAGAAGTTCGATGG + Intergenic
1001420999 5:171587048-171587070 CCTGAGATGGAGATGAGGGAGGG - Intergenic
1001620094 5:173076505-173076527 CTTTAGGAGGACAAGATGGGTGG + Intronic
1003255991 6:4475320-4475342 TCTTAGGAGCAGTTGAGGGAGGG + Intergenic
1005802950 6:29445589-29445611 CCACAGGAGGAGCTGATGCAGGG - Intronic
1007628610 6:43260230-43260252 CTTTAGGAGGTGAAGATGGGAGG + Intronic
1009648287 6:66438308-66438330 CCTGGTGAGGAGATGGTGGAGGG + Intergenic
1010564001 6:77385810-77385832 CCTTAGGAGGCCAAGATGGGAGG - Intergenic
1013462853 6:110392284-110392306 CCACAGGAGGAGATAATGTATGG - Exonic
1013604229 6:111732963-111732985 CTTTGGGAGGAGATGGGGGAGGG + Intronic
1016105243 6:140154224-140154246 TCTTAGGAGGAAATGAGGAAGGG - Intergenic
1016735753 6:147478019-147478041 TCTTGGCAGGAGATGATGAAAGG + Intergenic
1016999024 6:149982783-149982805 CCTCAGGAGAGGATGATGCAGGG + Intergenic
1018742246 6:166738855-166738877 CATTGGCAGGAAATGATGGATGG - Intronic
1019101904 6:169638440-169638462 CCTTAACAGGAGATGAGGAAAGG - Intronic
1019436017 7:1022556-1022578 CCGTGGGAGGAGGTGGTGGAGGG - Intronic
1020162806 7:5785079-5785101 CTTTAGGAGGGCAAGATGGAAGG - Intergenic
1021150711 7:17147702-17147724 ACTTTGGAGGAGGTGCTGGAAGG - Intergenic
1021281655 7:18727335-18727357 GCTAAGGAGGAGGTGATGGCAGG - Intronic
1025985645 7:66449010-66449032 CTTTGGGAGGACACGATGGATGG - Intergenic
1026205803 7:68256114-68256136 TCTTAGGAGGAGTTTATGGAGGG + Intergenic
1027389889 7:77694517-77694539 CTTTAGGAGGCGGTGATGGGTGG - Intergenic
1030213735 7:107022011-107022033 CCTTAGGGGGACAAGATTGACGG - Intergenic
1030354650 7:108528477-108528499 CTTTAGGAGGACAAGGTGGAAGG - Intronic
1031985029 7:128158637-128158659 CCAGAGGAGGAGATGGAGGATGG - Intergenic
1034277403 7:149829838-149829860 CAGGAGGAGGGGATGATGGAGGG - Intergenic
1034488049 7:151378560-151378582 TTTTGTGAGGAGATGATGGAAGG + Intronic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1037885593 8:22594572-22594594 GCTTTGGAGGGGATGGTGGAGGG + Intronic
1039346104 8:36707478-36707500 CTTTAGAATGAGATGAGGGAGGG - Intergenic
1040319940 8:46287406-46287428 CCTTAGGAGGACATTAAGGCAGG - Intergenic
1041861152 8:62513934-62513956 ACTTAGGAGTAGATGAAAGAAGG + Intronic
1042710661 8:71713376-71713398 CACTAGGAGGAAATGGTGGATGG - Intergenic
1044873702 8:96644705-96644727 TGTTAGGCGGTGATGATGGAAGG - Intergenic
1045839982 8:106568412-106568434 TATTGGGAGGAGAGGATGGAAGG - Intronic
1045991854 8:108317039-108317061 CCTTAGGAGCAGTTTAAGGAGGG - Intronic
1046507322 8:115152764-115152786 CCTTCTGAGGCGATGAGGGAGGG - Intergenic
1046975151 8:120266639-120266661 TCTGAGGATGAGACGATGGATGG + Intronic
1047145250 8:122191423-122191445 CAAGAGAAGGAGATGATGGAAGG - Intergenic
1048804303 8:138225662-138225684 TCTTAGGAGAAAATGATTGAGGG + Intronic
1049384147 8:142332611-142332633 CCTCATGAGGACATGGTGGATGG + Intronic
1050201829 9:3153158-3153180 CCTTAGCATGAGATGAGGCAGGG + Intergenic
1050806110 9:9680686-9680708 TCCTAGGAGGAGATGGTGGGAGG - Intronic
1051072146 9:13183417-13183439 CCTTAGGAGGAGATGATGGAAGG + Exonic
1052165136 9:25317347-25317369 CTTTAGGAGGAGCTCATGGAGGG + Intergenic
1052207853 9:25865291-25865313 ACATAGGAGAAGATGAAGGAAGG - Intergenic
1053799447 9:41755169-41755191 CCTGTGGAGGTGATTATGGAGGG + Intergenic
1054145768 9:61559828-61559850 CCTGTGGAGGTGATTATGGAGGG - Intergenic
1054187856 9:61967230-61967252 CCTGTGGAGGTGATTATGGAGGG + Intergenic
1054465511 9:65490932-65490954 CCTGTGGAGGTGATTATGGAGGG - Intergenic
1054650659 9:67621351-67621373 CCTGTGGAGGTGATTATGGAGGG - Intergenic
1055080080 9:72260057-72260079 CTTCAGGAGGAAATCATGGATGG + Intergenic
1057500324 9:95592486-95592508 CTTTAGGAGGCCAAGATGGAAGG - Intergenic
1057779691 9:98039584-98039606 CCTTAGGAGCAGTTTAGGGAGGG - Intergenic
1059160904 9:112034469-112034491 CCTATCGAGGAGATGATGTAGGG - Intergenic
1062624504 9:137436702-137436724 CCTCCGGAGGAGATGCTGGTGGG - Exonic
1186447536 X:9644386-9644408 CCAGAGGAGGAGAGGATGAAAGG + Intronic
1186546075 X:10451182-10451204 CATAAGCAGGAGAGGATGGACGG - Intronic
1186731507 X:12415375-12415397 ACTGGGGAGGAGAGGATGGATGG - Intronic
1187296547 X:18007091-18007113 TCGTAGGAAGAGAGGATGGAAGG + Intergenic
1187672012 X:21677302-21677324 CCTTAGGAGGAGTTCAGGAAGGG - Intergenic
1188611257 X:32100781-32100803 GCTTAGAAGGAGATGATAGCAGG - Intronic
1189753074 X:44242753-44242775 CAGTAGGAGGAGATGGTGGATGG - Intronic
1189907112 X:45772995-45773017 CTTTAGGAGGAAAATATGGATGG - Intergenic
1193279198 X:79627219-79627241 CCTTTGGAGATGATTATGGATGG - Intergenic
1194975468 X:100392055-100392077 CCTCAAGAGGAGATCATGGAAGG - Intronic
1195662773 X:107397269-107397291 CCTGAGGAGCAGATGATTGGTGG + Intergenic
1196163792 X:112515557-112515579 CTTTAGGAGGCCATGATGGGAGG + Intergenic
1196707540 X:118728534-118728556 CCTTAGGAGCAGCTCCTGGAAGG + Intronic
1197042973 X:121962289-121962311 TCTTAGGAGGAGTTTAGGGAGGG + Intergenic
1197752541 X:129975363-129975385 CTTTAGGAGGCGAAGAGGGAAGG + Intergenic
1198367088 X:135951695-135951717 CTTTAGGAGAGGGTGATGGAGGG + Intergenic
1198647287 X:138823157-138823179 CTTTGAGAGGAGATGATAGAGGG + Intronic
1199518833 X:148711953-148711975 CCAAAGGAGGAGATGAAGCAGGG - Intronic
1201534181 Y:15027644-15027666 TCTTAGGAGCAGATTAAGGAGGG - Intergenic