ID: 1051073139

View in Genome Browser
Species Human (GRCh38)
Location 9:13197725-13197747
Sequence ATGAAGAGGTATTGGTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 0, 2: 7, 3: 69, 4: 602}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051073139_1051073149 10 Left 1051073139 9:13197725-13197747 CCCAGTAACCAATACCTCTTCAT 0: 1
1: 0
2: 7
3: 69
4: 602
Right 1051073149 9:13197758-13197780 CTCAAACTCTTCCAAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051073139 Original CRISPR ATGAAGAGGTATTGGTTACT GGG (reversed) Intronic
900868762 1:5287130-5287152 ATGAAGAGAAATTGTCTACTGGG + Intergenic
902787283 1:18741004-18741026 ATGAAGAGAGGTTGGTTAATGGG + Intronic
905002766 1:34686069-34686091 ATGAAGAGTTAGTGTTTAATGGG + Intergenic
905073951 1:35253115-35253137 ATGGGGAGTTATTGTTTACTGGG + Intergenic
905700747 1:40011586-40011608 ATAAAGAGATATTGATTAGTGGG + Intergenic
905844914 1:41221259-41221281 ATGAGGAGTTATTGTTTAGTGGG + Intronic
906284123 1:44575150-44575172 ATGAAGAGAGGTTGGTTAATGGG - Intronic
906611133 1:47204261-47204283 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
906927935 1:50138848-50138870 ATGAGGAGGTATTGTTTAATGGG + Intronic
907490017 1:54803070-54803092 ATGAGGAGTTATTGTTTAATGGG - Intergenic
908102185 1:60802811-60802833 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
908345733 1:63230437-63230459 ATGAAGAGTTATTGTTTAGTGGG - Intergenic
908800054 1:67870777-67870799 ATAAAGAGAGATTGGTTAATGGG + Intergenic
908929510 1:69301798-69301820 ATGGAGAGTTATTGTTTAATGGG + Intergenic
909140169 1:71854561-71854583 ATGAAGAAATATTCGTGACTGGG + Intronic
909377188 1:74952836-74952858 ATAAAGACGTACTGGATACTGGG - Intergenic
909435583 1:75637511-75637533 ATGGAGAGTTATTGCTTAATGGG + Intergenic
909437695 1:75662374-75662396 ATGAAGAGGGGTTGGATAATAGG + Intergenic
910373350 1:86542152-86542174 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
910375079 1:86559664-86559686 ATTAAGAGGAATTGATTAATAGG - Intronic
910751091 1:90631769-90631791 ATGAGGAGGTATTGGTCAAAGGG + Intergenic
911100433 1:94091660-94091682 TGGAAGAGTTATTTGTTACTTGG - Intronic
911172978 1:94789696-94789718 ATGAAGAGAGCTTGGTTAATGGG + Intergenic
911185434 1:94899352-94899374 ATAAAAAGGTATTGCTTACCTGG + Exonic
911238581 1:95439381-95439403 ATGAAGAGAAGTTGGTTAATGGG - Intergenic
911238957 1:95443952-95443974 ATAAAGAGGGGTTGGTTAATGGG - Intergenic
911837542 1:102640527-102640549 ATAAAGAGAAGTTGGTTACTGGG - Intergenic
911935627 1:103967170-103967192 ATGAAGAGTTGTTGTTTAATCGG - Intergenic
912178547 1:107190168-107190190 ATGAAGAGTTATTGTTTAATGGG + Intronic
912885217 1:113464124-113464146 ATGAAGAGGAGTTGATTAATAGG - Intronic
913035238 1:114958306-114958328 ATGAAGAGGGATTGATTAATGGG + Intronic
913038084 1:114993859-114993881 ATAAAGAGTTATTGTTTAATGGG - Intronic
913043029 1:115047398-115047420 ATGAAGAGGGATTGATTACTGGG + Intergenic
913094170 1:115500635-115500657 ATGTAGAGTTATTGTTTAATGGG + Intergenic
913262721 1:117014408-117014430 ATGAAGAGGTAATTGATAGTGGG + Intronic
913567608 1:120088535-120088557 AAGAATAGCTAATGGTTACTGGG - Intergenic
913720840 1:121592729-121592751 AAGAAGAGTAATTGGTTAATGGG + Intergenic
914734603 1:150403406-150403428 ATGGAGAGTTATTGTTTAATGGG - Intronic
915707640 1:157861711-157861733 ATGAGGAGTTATTGTTTAATGGG + Intronic
916333766 1:163646984-163647006 ATGAAGATGGATTAGTTGCTAGG - Intergenic
917221428 1:172733037-172733059 ATGAAGAGAGTTTGGTTAATGGG + Intergenic
917261039 1:173169761-173169783 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
918196302 1:182225556-182225578 ATAAAGAGGGATTGGCTAATGGG - Intergenic
918787479 1:188781303-188781325 ATTATGATGTAATGGTTACTGGG - Intergenic
919034508 1:192289308-192289330 ATGAATAGGAGTTGGTTAATAGG + Intergenic
919066988 1:192704784-192704806 ATGAAGAGAAGTTGGTTAATGGG - Intergenic
919662153 1:200257774-200257796 ATGAAATGGTATTGGTATCTCGG + Intergenic
920829825 1:209454065-209454087 ATGAAGAGGGGTTGGTTAATGGG - Intergenic
921147656 1:212374434-212374456 ATGAAGAGAAATTGGTTAATGGG + Intronic
921175679 1:212592133-212592155 ATGAGGAGTTATTGTTTAATGGG - Intronic
921379782 1:214512557-214512579 ATGGAGAGGTGTTGTTTAATGGG + Intronic
921666529 1:217879240-217879262 ATGAACAGGTAATGGTCATTTGG - Intergenic
922773544 1:228203809-228203831 ATGAAGAGGGGCTGGTTAATGGG + Exonic
923475336 1:234326318-234326340 ATGGAGAGTTATTGTTTAGTGGG + Intergenic
923871928 1:238004522-238004544 ATGGAGAGTTATTGTTTAATGGG - Intergenic
923885631 1:238152136-238152158 ATGAAGAGGAATTGGGAGCTGGG + Intergenic
924003126 1:239575935-239575957 ATGGAGAGTTATTGTTTAATGGG - Intronic
924210475 1:241760970-241760992 AAGAAGAGGGATTGGTTGCTGGG + Intronic
1063501230 10:6556544-6556566 ATGGAGAGTTACTGCTTACTGGG + Intronic
1064334951 10:14431241-14431263 ATGAAGAGAAGTTGGTTAATGGG + Intronic
1064680178 10:17803560-17803582 ATGGAGAGTTATTGTTTAATGGG - Intergenic
1065501789 10:26390538-26390560 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
1065505507 10:26426551-26426573 AGGAAGAAGGATTGGATACTGGG - Intergenic
1065728511 10:28690045-28690067 ATGAAGAGAGCTTGGTTAGTAGG - Intergenic
1065734880 10:28742564-28742586 ATGAGGAGCTATTGGTTAAGGGG + Intergenic
1065994540 10:31045198-31045220 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1066527155 10:36294368-36294390 ATGAAGAGAGATAGGTTAATGGG - Intergenic
1066589307 10:36976272-36976294 ACAAAGAGGGATTGGTTAATGGG + Intergenic
1066685190 10:37975128-37975150 ATGAAGAGAGGTTGGTTAATGGG + Intronic
1066951226 10:42119448-42119470 ATGGAGAAGTATTGTTTAATGGG + Intergenic
1067351899 10:45483922-45483944 ATAAAGAGAGATTGGTTAATGGG + Intronic
1067688469 10:48482903-48482925 ATGAAGAGAGGTTGGTTAATGGG - Intronic
1068096992 10:52503904-52503926 AGGAAGAGGAGTTGGTTAATAGG + Intergenic
1069414839 10:68189486-68189508 ATGAAGAGAGGTTGGTTAATGGG - Intronic
1069461315 10:68597967-68597989 ATGAGGAGTTATTGTTTAATGGG + Intronic
1070556971 10:77535905-77535927 ATTAAGAGGGATTGGTTGATAGG + Intronic
1071741481 10:88363276-88363298 ATGAAGAGCTAATGGATGCTGGG + Intronic
1071774599 10:88771380-88771402 ATAAAGAGGCATTGGTTAATGGG - Intronic
1072814611 10:98492960-98492982 ATGAAGAGTTAATGTTTAATGGG - Intronic
1072874900 10:99162035-99162057 ATGAAGAGTTATTTTTTAATAGG + Intronic
1072976112 10:100060097-100060119 ATGGAGAGTTATTGTTTAATGGG + Intronic
1074009104 10:109458403-109458425 ATGAAGAGATGTTGGTTAAAGGG - Intergenic
1074127247 10:110538717-110538739 ATGAAGAGAAATTGATTAATGGG + Intergenic
1074235738 10:111582819-111582841 ATGAAGAAATATTCGTGACTGGG + Intergenic
1074463640 10:113662623-113662645 ATGGAGAATGATTGGTTACTGGG - Intronic
1074525322 10:114258048-114258070 AAGCAGAGGAATTGTTTACTTGG + Intronic
1074634634 10:115300870-115300892 ATGGAGAGTTATTGTTTAATGGG - Intronic
1074801044 10:117001604-117001626 ATGAAGAGAGATTGTTTAATGGG + Intronic
1075863789 10:125699709-125699731 ATGGTGAGTTATTGGTTAATGGG + Intergenic
1077826572 11:5816179-5816201 ATGGAGAGTTATTGTTTAATGGG + Intronic
1078584034 11:12565210-12565232 ATGAAGAGATGTTGATTAATGGG - Intergenic
1079202897 11:18390625-18390647 ATGAAGAGGGATTGGTTAATGGG - Intergenic
1079275225 11:19029149-19029171 ATGAAGAGGGGTTGGCTAATGGG + Intergenic
1079487289 11:20948601-20948623 ATGAAGAGAATTTGGTTAATGGG - Intronic
1079812544 11:25013241-25013263 ATGAAGAGGAGTGGGTTAATGGG + Intronic
1079852544 11:25555131-25555153 AAGAAGATGGGTTGGTTACTGGG - Intergenic
1081105365 11:39060861-39060883 ATGAAGAGCAGTTGGTTAATGGG - Intergenic
1081233210 11:40612396-40612418 ATGAGGAGGTATTGTTCAATGGG + Intronic
1081828454 11:46082343-46082365 AGGTAGGGGTGTTGGTTACTAGG - Intronic
1081943401 11:46964966-46964988 AGGAAAAGGAATTGGTTAGTAGG + Intronic
1081956188 11:47096323-47096345 ATGAGGAGTTATTGTTTAATGGG - Intronic
1082207949 11:49461642-49461664 ATGAATAGCTAATGGGTACTGGG - Intergenic
1084658052 11:70530740-70530762 ATGAAGAGCTAGTGTTTACTGGG + Intronic
1085098315 11:73778849-73778871 ATGGGGAGTTATTGCTTACTGGG + Intergenic
1085830997 11:79900872-79900894 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
1085881149 11:80467295-80467317 ATAAATAACTATTGGTTACTAGG + Intergenic
1086353087 11:85963017-85963039 ATGAAGAGGCAATGGGTTCTTGG + Intronic
1086571309 11:88287654-88287676 ATAAAGAGATGTTGGTTAATGGG - Intergenic
1086663851 11:89455937-89455959 ATGAAGAGGCAATGGTTAACAGG + Intronic
1086874754 11:92082081-92082103 ATAAAGAGAAATTGGTTAATGGG + Intergenic
1086975285 11:93125215-93125237 ATGAAGAGTTATTGTTTAATGGG - Intergenic
1087147689 11:94828248-94828270 ATCAACAGGTTTTGGTGACTGGG - Intronic
1088271542 11:108039613-108039635 ATGAAGAATTATTGTTTAATGGG - Intronic
1088377261 11:109155499-109155521 ATGAGAAGGTAGTGTTTACTGGG + Intergenic
1088743134 11:112783214-112783236 CTGAATAGTTGTTGGTTACTGGG - Intergenic
1088791996 11:113234425-113234447 ATGAAGAGCTAGTGTTTAATGGG - Intronic
1089210625 11:116798679-116798701 AGGAGAAGGTATTGGTTAATAGG + Intergenic
1090140958 11:124260946-124260968 ATGAAGAGATATGGATTAATGGG - Intergenic
1090241515 11:125185499-125185521 ATGCAGAGTTATTGCTTAATAGG - Intronic
1090590655 11:128263448-128263470 ATGAAGAGAAGTTGGTTAATGGG - Intergenic
1091252911 11:134158794-134158816 ATGAAGAGAAGTTGGTTAATGGG - Intronic
1092665024 12:10786633-10786655 ATGAAGAGATATTGGTCAAAGGG - Intergenic
1093103699 12:15059738-15059760 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1095501214 12:42840601-42840623 ATGAAGAGATGTTGGTCAATTGG - Intergenic
1095803731 12:46295620-46295642 ATGAAGAGAGATTGATTAATGGG + Intergenic
1095933259 12:47650349-47650371 GTGATGAGGTATTGCTCACTGGG - Intergenic
1096014667 12:48258757-48258779 ATGGAGAGTTATTGTTTAATGGG + Intergenic
1097334213 12:58364301-58364323 ATGAAGAGGAACTGGGTAGTGGG + Intergenic
1097460975 12:59861458-59861480 ATGAAGAGACATTGGTTAAAGGG - Intergenic
1097477599 12:60077812-60077834 ATAAAGAGGGATTGGTTAATTGG - Intergenic
1098177942 12:67813364-67813386 ATGAGGAGGTGTTGTTTAATGGG - Intergenic
1099192152 12:79571585-79571607 ATTAAGAGGTATTGCTGGCTGGG - Intergenic
1099206636 12:79736003-79736025 ATAAAGAGGAATTGGTTAGTGGG + Intergenic
1099277318 12:80593213-80593235 ATAAAGAGTTATTGATTAATGGG + Intronic
1100625707 12:96329147-96329169 ATGTGGAGGTATTGTTTAATGGG + Intronic
1100854602 12:98747968-98747990 ATGAAGAGAGATTGGTTAATAGG + Intronic
1100921332 12:99491496-99491518 ATAAATAAGTATTGGATACTAGG - Intronic
1100928667 12:99580613-99580635 GTGAAGAGAAATTGGTTAATGGG + Intronic
1101143180 12:101817064-101817086 ATGAAGAGTGATTGGCTAATAGG + Intronic
1101162736 12:101995386-101995408 ATGAAGAGGTATTAGTAGCAGGG - Intronic
1101682485 12:106983290-106983312 ATGGAGAGTTATTGTTTAATGGG - Intronic
1102200043 12:111050869-111050891 ATGAAGAGAGGTTGGTTAATGGG + Intronic
1103257966 12:119559271-119559293 ATGGGGAGGTATTGCTTAATGGG - Intergenic
1104200849 12:126587261-126587283 ATGGAGAGTTATTGTTTAATGGG + Intergenic
1104344117 12:127980504-127980526 ATGAAGAGAGCTTGGTTAATGGG - Intergenic
1105682296 13:22741436-22741458 ATGAGGAGAGATTGGTTAATGGG + Intergenic
1105986078 13:25568616-25568638 ATGGAGAGTTATTGTTTAATGGG + Intronic
1106368670 13:29109450-29109472 ATGGGGAGGTATTGGTTAAAGGG - Intronic
1106784731 13:33095352-33095374 ATAAAGAGAGATTGGTTAATGGG - Intergenic
1107535911 13:41331663-41331685 ATGAAGAGAGGTTGGTTAATGGG + Intronic
1107607845 13:42079422-42079444 ATGATGAGAAATTGGTTAGTGGG - Intronic
1107809346 13:44185108-44185130 ATGAAGAGAGGTTGGTTAATAGG + Intergenic
1108118481 13:47157661-47157683 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1108216772 13:48193213-48193235 ATGAGGAGTTATTGTTTAATGGG - Intergenic
1108307444 13:49152607-49152629 ATGACGAGTTAGTGGTTAGTGGG - Intronic
1108461919 13:50675560-50675582 GTGATGAGATATTGGTTAGTGGG - Intronic
1108639407 13:52368935-52368957 ATGGAGAGGTGTTGTTTAATGGG + Intergenic
1109182919 13:59235306-59235328 ATGAAGAGGGGTTGGTTAATGGG - Intergenic
1109303790 13:60617002-60617024 ATGAAGAAAACTTGGTTACTGGG - Intergenic
1109479746 13:62934463-62934485 ATGAGGAGGTATTGGTTAACGGG - Intergenic
1109725384 13:66334162-66334184 ATGAAGAGAGGTTGGTTAATGGG - Intronic
1110011942 13:70347109-70347131 ATGAAGAGGGATTCATTAATGGG + Intergenic
1110013301 13:70366280-70366302 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
1110013458 13:70368123-70368145 ATGGAGAGTTATTGTTTAGTGGG + Intergenic
1110049038 13:70871897-70871919 ATGAAGAAATATTTGCTACTGGG + Intergenic
1110330578 13:74267599-74267621 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
1110754691 13:79159012-79159034 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1111204317 13:84984445-84984467 ATGAAGAGAAATAGATTACTGGG + Intergenic
1111608475 13:90572259-90572281 ATGAAGACAGATTGGTTAATGGG - Intergenic
1111786256 13:92790298-92790320 ATGAAGAGATACAGGTTTCTAGG + Intronic
1112081448 13:95976073-95976095 ATGAGGAGGGGTTGGTTAATGGG - Intronic
1112808564 13:103189882-103189904 ATGAACAGGTTATGTTTACTTGG + Intergenic
1112885762 13:104168944-104168966 ATGAAGAGAAGTTGGTTAATGGG + Intergenic
1113320452 13:109227658-109227680 ATGAAGAGGTAGTAATTATTGGG + Intergenic
1114258008 14:21018754-21018776 ATGAAGATGCAGTGGTTAGTAGG - Exonic
1114523068 14:23351060-23351082 GGGAAGAGTTATTGGTTGCTGGG + Intronic
1115730737 14:36266634-36266656 ATGAAGAGACATTGATTAATGGG + Intergenic
1116256124 14:42558809-42558831 ATAAAGAGGGATTGGTTAATGGG - Intergenic
1116300292 14:43171534-43171556 ATGAAAAGACATTGGTTAATGGG + Intergenic
1116548477 14:46202720-46202742 ATGAAGAGAAGTTGGTTAATAGG + Intergenic
1116747288 14:48836873-48836895 GTGAAGAGGGGTTGGTTAATGGG - Intergenic
1117051393 14:51863664-51863686 AAGAGGAGGTATTGATTAATGGG - Intronic
1117143954 14:52818094-52818116 ATGGGGAGCTATTGCTTACTGGG - Intergenic
1117206653 14:53450461-53450483 ATGAGGGAGTATTGCTTACTGGG + Intergenic
1117890437 14:60415692-60415714 ATGGAGAGTTATTGTTTAATGGG + Intronic
1118149532 14:63174832-63174854 ATGAGGAGGCATTGGCCACTAGG + Intergenic
1118813099 14:69289668-69289690 AGGAAGAGGAAATGGATACTAGG + Intronic
1119596296 14:75937501-75937523 ATGAGGAGTTATTGTTTAATGGG - Intronic
1119871124 14:78018434-78018456 ATGAGGAGTTATTGTTTAATAGG + Intergenic
1119885003 14:78132845-78132867 ATGCAGAGATATTGGTTAAAGGG + Intergenic
1120085644 14:80269593-80269615 AGAAAGAGGTATTTGTTAATGGG + Intronic
1120086804 14:80284866-80284888 ATGAGGAGTTATTGTTTAATGGG - Intronic
1121828727 14:97031905-97031927 ATAAAGAGAGATTGGTTATTGGG + Intergenic
1122149106 14:99715016-99715038 ATGAAGAGAAGTTGGTTAATGGG + Intronic
1122546487 14:102525557-102525579 ATGGGGAGGTATTGTTTAATGGG + Intergenic
1125101543 15:35918751-35918773 ATGAAGAGAGAATGGTTAATAGG + Intergenic
1125315386 15:38425978-38426000 ATGAAGAGAGATTGGTCAATGGG + Intergenic
1125710320 15:41780027-41780049 ATGAAGAGGTGTTGGGTCCAGGG - Intronic
1126719482 15:51561986-51562008 ATGAAGAGAAATTGGTTAATTGG + Intronic
1127063242 15:55209263-55209285 ATGAAGAGAGATTGATTAATAGG - Intronic
1127403766 15:58619347-58619369 ATAAAGAGAGATTGGTTAATGGG + Intronic
1128006392 15:64245959-64245981 ATGAAGAGAGCTTGGTTAATGGG + Intronic
1129075701 15:72994059-72994081 TTGAAGCGGTTTTGGTTATTTGG + Intergenic
1129963011 15:79705853-79705875 ATGAAGAGATGTTGGTTAATAGG - Intergenic
1130611375 15:85364281-85364303 TTGAAGAAGTGTTGGTTCCTTGG - Intergenic
1131065434 15:89432146-89432168 ATGGAGAGTTATTGTTTAATAGG + Intergenic
1131237792 15:90712004-90712026 ATGAGGAATTATTGCTTACTGGG - Intergenic
1133530730 16:6652769-6652791 GTGAAGAGTTATTGTTTAATGGG + Intronic
1133866534 16:9649143-9649165 ATGAAGAGAAATTGGTTAATGGG + Intergenic
1134898634 16:17913850-17913872 ATGAAGAGAGATTGGTGAATAGG + Intergenic
1135111424 16:19693307-19693329 ATGAAGAGAGGTTGGTTAATGGG + Intronic
1135585871 16:23670447-23670469 AGGAAGAGGTCTTGGTGGCTAGG + Exonic
1135736502 16:24935816-24935838 ATAAAGAGCTAATGTTTACTTGG + Intronic
1135803897 16:25524593-25524615 ATGAAGAGAAACTGGTTAATGGG - Intergenic
1138977479 16:62225286-62225308 ATGAAGACAGATTGGTTAATGGG + Intergenic
1139344154 16:66291375-66291397 ATGAAGAGATACTGATTAATGGG + Intergenic
1140471059 16:75214935-75214957 ATGCAGAGTTATTGTTCACTGGG - Intergenic
1144053686 17:11519499-11519521 ATGAAGAGTTGTTGTTTATTGGG + Intronic
1144076516 17:11724312-11724334 ATGAAGAGAAGTTGGTTAATGGG - Intronic
1144257845 17:13487170-13487192 ATGAAGAGTTACTGTTTAGTGGG + Intergenic
1145358812 17:22192809-22192831 ATGAGGAGACATTGGTTAATGGG + Intergenic
1146697607 17:34921699-34921721 ATGAGGAGTTATTGTTTAATGGG + Intergenic
1146698812 17:34935258-34935280 ATGGAGAGATATTGTTTAATGGG + Intronic
1147349796 17:39832739-39832761 ATGAAGAGAGATTAGTTAATGGG + Intronic
1147502599 17:40979761-40979783 ATGAAGAGAGGTTGGTTAATGGG + Intronic
1148865787 17:50627922-50627944 ATGAAGCTGTTTTGGTTAATGGG + Intergenic
1149127311 17:53251178-53251200 ATGAAGAGAGGTTGGTTAATTGG - Intergenic
1149717307 17:58804987-58805009 ATGAAGAGAGATTGGTCAATGGG - Intronic
1149907913 17:60543651-60543673 ATGAGGAGTTATTGTTTAATAGG - Intergenic
1150536211 17:66044709-66044731 ATGGAGAATTATTGTTTACTGGG + Intronic
1150733180 17:67713571-67713593 ATGGAGAGTTATTGTTTAATGGG + Intergenic
1152032060 17:77849178-77849200 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1154248116 18:12717874-12717896 ATGACCATGTATTGGTTATTAGG + Intronic
1154367908 18:13727715-13727737 AAGAAGAGAAATTGGTTAATGGG - Intronic
1155047908 18:22119342-22119364 ATGAAGACAGATTGGTTAATGGG - Intergenic
1155118614 18:22795642-22795664 ATGAAGAGTTATTGTTTAATGGG + Intergenic
1155186715 18:23393389-23393411 ATGAAGAGATAGTGTTTAATGGG - Intronic
1155248451 18:23933659-23933681 ATGAAGAGGGGTTGGTTAATGGG - Intronic
1155365964 18:25049346-25049368 CTCAAGAGGTAGTGGTGACTGGG - Intergenic
1155662047 18:28260819-28260841 ATGAAGAGAAGTTGGTTAATGGG + Intergenic
1155717393 18:28961972-28961994 AGGAAAAGGTGTTGGTTATTGGG - Intergenic
1156510302 18:37630909-37630931 ATGAAGGGTTATTGTTTAATGGG - Intergenic
1157398062 18:47360201-47360223 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1157500608 18:48187891-48187913 ATGAGGAGTTATTGTTTAATGGG + Intronic
1157531391 18:48423759-48423781 ATGGAGAGTTATTGCTTAATGGG + Intergenic
1158224814 18:55189949-55189971 ATGGAGAGTTGTTTGTTACTTGG - Intergenic
1158578043 18:58656813-58656835 ATGGGGAGGTATTGTTTAATGGG + Intergenic
1158578696 18:58662518-58662540 ATGGGGAGGTATTGTTTAATAGG - Intergenic
1159111656 18:64066091-64066113 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1159700072 18:71615747-71615769 ATGAAGAGAGACTGGTTAATGGG + Intergenic
1163059125 19:14745527-14745549 ATGAAGAGAGGTTGGTTAATGGG - Intronic
1163096413 19:15060785-15060807 GTGAAGAGAAATGGGTTACTGGG + Intergenic
1165977595 19:39690842-39690864 ATGAGGAGATATAGGTTTCTAGG - Intergenic
1166618863 19:44277073-44277095 ATGAAGAGAGGTTGGTTAATGGG - Intronic
1167986431 19:53321736-53321758 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1168383265 19:55942209-55942231 ATGAAGAGCGGTTGGTTAATAGG - Intergenic
1168477835 19:56690378-56690400 ATGGAGAGTTATTGCTTAATAGG - Intergenic
926327980 2:11801620-11801642 ATGAAGAGAGGTTGGTTAATGGG + Intronic
926346824 2:11954593-11954615 AGGAAGAGGCATTGGTCAATAGG + Intergenic
926897578 2:17711196-17711218 AGGAAGAGGTAGTTGTGACTTGG - Intronic
927035485 2:19170908-19170930 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
927732891 2:25490692-25490714 ATGAAGACTTTTTGATTACTTGG + Intronic
927734433 2:25506158-25506180 ATGAAGAGAGGTTGGTTAATGGG + Intronic
928162792 2:28943996-28944018 TTGGAGAAGTATTGGTCACTGGG - Intronic
928169844 2:28996368-28996390 ATGAAGAGAGGTTGGTTAATGGG - Intronic
928181916 2:29073961-29073983 ATGAAGAGGTTTTGGTTCCTGGG + Exonic
928478215 2:31653145-31653167 CTGAAGAGGTATTGGCTGGTTGG - Intergenic
928589474 2:32799237-32799259 ATGAAGAGTTATGGTTTAATGGG + Intronic
928862192 2:35872496-35872518 ATGAAGCGGGATTGGTCCCTTGG - Intergenic
928999677 2:37333921-37333943 ATGTAGAGGTATTGTTTAATGGG + Intergenic
929072897 2:38051650-38051672 ATGAAGAGAGGTTGGTTAATGGG - Intronic
929084068 2:38150291-38150313 ATGAAGAGAGGTTGGTTAATAGG - Intergenic
929538764 2:42803351-42803373 ATGGAGAGTTATTGTTTAATGGG + Intergenic
929953360 2:46434718-46434740 ATGAAGAGGTAGAGGTTCTTGGG - Intronic
930170943 2:48251141-48251163 ATGAAGAGTTATTGCTTAACAGG + Intergenic
930398273 2:50849567-50849589 AAGAAGAGTTATTGATAACTGGG - Intronic
930721113 2:54639289-54639311 ATGAAGAGGTGTTTGTAGCTTGG + Intronic
930924040 2:56794483-56794505 ATAAAGCGGAATTGCTTACTCGG + Intergenic
931648428 2:64446736-64446758 ATGAAGAGGGATTGGTTAACAGG + Intergenic
931658596 2:64534482-64534504 AAGAAGAGGAAGTGGTAACTTGG - Intronic
932491060 2:72121025-72121047 ATGCATAGATATTGGTTATTGGG - Intergenic
933562560 2:83906612-83906634 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
933974817 2:87500591-87500613 ATGAGGAGTTATTGTTTAATGGG + Intergenic
935244792 2:101208815-101208837 ATGAAGAGAGGTTGGTTAATGGG - Intronic
935415313 2:102810007-102810029 ATGAGCAGTTATAGGTTACTTGG - Intronic
936319008 2:111450222-111450244 ATGAGGAGTTATTGTTTAATGGG - Intergenic
937129862 2:119501491-119501513 ATGAACAGATGTTGGTTAATGGG + Intronic
937430567 2:121834600-121834622 ATGAAGAGCTATTATTTAGTGGG + Intergenic
937889129 2:126922912-126922934 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
938473615 2:131588800-131588822 ATGAAGAGAAGTTGGTTATTGGG + Intergenic
938702810 2:133894268-133894290 AGGAACAGGGATTGCTTACTAGG + Intergenic
939058248 2:137388636-137388658 ATGAAGAGAGGTTGGTTAATGGG - Intronic
939492032 2:142887767-142887789 ATGAGGAGTTATTGTTTAATGGG + Intronic
940270720 2:151887131-151887153 CTGAAGACGTAAAGGTTACTAGG + Intronic
940325246 2:152418437-152418459 ATGAAGAGTTACTGTTTAATGGG - Intronic
940345639 2:152624885-152624907 ATGAAGATATATTGGCTGCTGGG - Intronic
940431707 2:153599360-153599382 ATGAAGAGAGATTGATTAATGGG - Intergenic
941080750 2:161057956-161057978 AAGAAGAGGCTTTGGATACTGGG - Intergenic
941099021 2:161276814-161276836 ATAAAGAGGGATTGGTTAATGGG - Intergenic
942159367 2:173166064-173166086 ATGAGGAGTTATTGCTTAATGGG - Intronic
942334891 2:174872838-174872860 ATGAAGAATTATTGCTTTCTGGG - Intronic
942883225 2:180888889-180888911 ATACAGAGGGATTGGTTAGTGGG + Intergenic
943055496 2:182972917-182972939 ATAAAGAAGGATTGGTTAATGGG + Intronic
943138294 2:183943918-183943940 ATAAAGAGGGATTGGTTGATGGG + Intergenic
943175659 2:184470094-184470116 ATGAAGAGAAGTTGGTTAATGGG + Intergenic
943274636 2:185851448-185851470 ATGAAAAGATATTGTTTAATGGG + Intergenic
944219547 2:197288921-197288943 ATGAAGAGAGGTTGGTTAATGGG + Intronic
944267128 2:197740746-197740768 AGGAAGAGTTATTGCTTAATGGG + Intronic
945602383 2:211884264-211884286 AAGAAGAGGAATTGGTGAGTAGG - Intronic
945659431 2:212667343-212667365 ATGTAGGGGTATTGGTTTATGGG + Intergenic
945686991 2:212983554-212983576 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
945865939 2:215175760-215175782 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
945997059 2:216446668-216446690 GTGAACATTTATTGGTTACTTGG + Intronic
946015023 2:216597102-216597124 GTAAAGAGCTAATGGTTACTGGG - Intergenic
946352261 2:219162843-219162865 AGGAAGAGGGAGTTGTTACTAGG - Intronic
947165987 2:227262803-227262825 GTGAAGAGAGATTGGTTAATGGG + Intronic
948245056 2:236475099-236475121 ATGAAGAGAGATTGATTAATGGG - Intronic
1169202377 20:3718096-3718118 ATAAAGATGAATTGGTTACCAGG + Intergenic
1169624631 20:7550622-7550644 ATGTAGAGGTACTAATTACTGGG + Intergenic
1169751825 20:9002426-9002448 ATGAAGAAGTATTGGTTGCTAGG - Intergenic
1170093586 20:12620087-12620109 ATGAAGGGAGATTGGTTAATGGG + Intergenic
1170240232 20:14157520-14157542 ATGAAGAGAGGTTGGTTAATGGG - Intronic
1170335004 20:15260254-15260276 ATAAAGAGGGAATGGTTAATGGG - Intronic
1170801936 20:19597694-19597716 ATGAAGAGAGGTTGGTTAATGGG - Intronic
1171064423 20:22000126-22000148 ATGAAGAGGGGTTGGTCAATAGG + Intergenic
1171508996 20:25664592-25664614 ATGAAAAGGCATTGGTTAATGGG - Intergenic
1172757660 20:37298373-37298395 ATGGGGAGATATTGTTTACTGGG - Intronic
1172979970 20:38933781-38933803 ATGAAGAGCTAGTGTTTAATGGG - Intronic
1175589769 20:60179826-60179848 ATGGAGAGTTGTTGGTTAATGGG - Intergenic
1176897491 21:14398804-14398826 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1177090929 21:16767320-16767342 ATGAAGAGTTATTGTTTAGTGGG + Intergenic
1177459313 21:21389556-21389578 ATGAAGAGAGATTGGTTAATGGG - Intronic
1178230822 21:30782166-30782188 ATGGAGAGGGATTGGTGATTGGG + Intergenic
1178794887 21:35734689-35734711 ATGAAGAGGGGTAGGTTAATGGG + Intronic
1178998024 21:37424980-37425002 ATGAAGTAGTATTGTATACTTGG + Intronic
1180648565 22:17360016-17360038 ATGAAGAGGTATGTGGAACTTGG + Intronic
1183118410 22:35710682-35710704 ATGAGGAGTTATTGTTTACTTGG - Intergenic
1183130713 22:35832500-35832522 ATGGAGAGAGGTTGGTTACTGGG + Intronic
1183158297 22:36092639-36092661 ATGGGGAGGTATTGTTTAATGGG - Intergenic
949246276 3:1928376-1928398 ATGAATAGGGTTTGGTTAATGGG + Intergenic
949276051 3:2283003-2283025 ATGGAGAGTTATTGCTTAATGGG + Intronic
949347891 3:3094250-3094272 AAGGAGAGGTATTGTTTAATGGG - Intronic
950056668 3:10030457-10030479 TTGAAGAGTTATTTCTTACTAGG + Intronic
951095708 3:18627447-18627469 ATGAGGAGTTATTGTTTAATGGG + Intergenic
951446760 3:22790950-22790972 ATAAAGAGGGTTTGGTTAATGGG + Intergenic
951606167 3:24437397-24437419 ATGAAGAGAAGTTGGTTAATGGG + Intronic
951977759 3:28532276-28532298 ATGAAGAGTGATTGGTTAATGGG + Intronic
952192354 3:31037245-31037267 ATGATGAGAAATTGGTTAATGGG + Intergenic
952243206 3:31556020-31556042 ATGAAGAGAGATTGGTCAATGGG - Intronic
952441134 3:33330367-33330389 ATGAAGAGAGATTGATTAATGGG + Intronic
952543263 3:34390784-34390806 ATGAAGAAAGATTGGTTAATGGG - Intergenic
952675169 3:36021070-36021092 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
953479259 3:43235721-43235743 ATGAAGAGTTATTTTTTAATGGG - Intergenic
954493210 3:50927288-50927310 ATGAGGAGGGATTGGTTAGTGGG + Intronic
954568079 3:51616248-51616270 ATGAAGAGAGATTGATTAATGGG - Intronic
954842329 3:53522890-53522912 ATGAAGAGAGGTTGGTTAATGGG - Intronic
955632198 3:60986501-60986523 GTGGAGAGGTATTGGTTAATAGG + Intronic
956188917 3:66589769-66589791 ATGAAGAGAGTTTGGTTAATGGG - Intergenic
956829939 3:73036263-73036285 ATGAATAGAAATTGGTTACTGGG + Intronic
956834788 3:73087963-73087985 ATGAAGAGAGATTGACTACTGGG - Intergenic
957667951 3:83260727-83260749 ATGTAGAGTTATGGGTTACAGGG + Intergenic
957748153 3:84372585-84372607 AAGAACAGCTAATGGTTACTGGG + Intergenic
957941369 3:87008913-87008935 ATGAAGAGAAGTTGGTTAATAGG - Intergenic
958771503 3:98431136-98431158 ATGAAGAGAGATTGATTAATGGG + Intergenic
958961627 3:100515858-100515880 ATGAAGAGAGGTTGGTTAATGGG + Intronic
959016500 3:101140165-101140187 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
959217159 3:103465668-103465690 ATGAAGAGAGGTTGGTTAATAGG - Intergenic
959246193 3:103872167-103872189 ATGAAGAGAGGTTGGTTAATTGG + Intergenic
959595824 3:108127450-108127472 AGGCAGAGGTATTGTTTCCTGGG + Intergenic
959655857 3:108804161-108804183 ATGAAGAGAGGTTGGTTAATAGG + Intergenic
959731961 3:109614219-109614241 ATGAAGAGAAATTGGTTAAGAGG + Intergenic
959760021 3:109950664-109950686 ATAAAGAGGGGTTGGTTAATGGG + Intergenic
959913504 3:111791945-111791967 ATGAAGAGGTTATGGTTAATGGG - Intronic
960221309 3:115112427-115112449 ATGAAGAGAGGTTGGTTAATGGG - Intronic
960283292 3:115799761-115799783 AGGAAGAGGAATTGCTCACTCGG - Intergenic
960419155 3:117422427-117422449 GTGGAGAGATAGTGGTTACTGGG - Intergenic
960854526 3:122089179-122089201 AAGAAGAGTTATTGTTTAATAGG + Intronic
961221518 3:125204592-125204614 ATGAAGAGAGGTTGGTTAATGGG + Intronic
962229481 3:133649072-133649094 AGTAAGAGGTATTTGTTACAAGG + Intronic
962650537 3:137484505-137484527 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
962743313 3:138379148-138379170 ATGAAGAGAAGTTGGTTAATGGG - Intronic
963026900 3:140928718-140928740 ATGGAGAGCTATTGTTTAATGGG - Intergenic
963615375 3:147530066-147530088 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
963758940 3:149265819-149265841 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
963853496 3:150230505-150230527 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
965631526 3:170738222-170738244 ATGAAGAGAGGTTGGTTAATGGG + Intronic
965664629 3:171080016-171080038 ATGAAGAAGTGTTGGCAACTGGG + Intronic
965962917 3:174450383-174450405 AGGAAGAGGATTTGGTTAATAGG + Intronic
966106349 3:176340222-176340244 ATGAAGAGTGATTGGTTAATGGG - Intergenic
966158204 3:176940926-176940948 ATGAAGAGGAGTTGGCTAATGGG + Intergenic
966284846 3:178283044-178283066 ATGGAGAGTTATTGTTTACTGGG + Intergenic
966458404 3:180144834-180144856 ATGGAGAGTTATTGTTTAATAGG + Intergenic
967107513 3:186266133-186266155 TTGAAGAGGTAGTAGTTACGAGG - Intronic
967487282 3:190047796-190047818 ATGAAGAGGCATTGGTTAATGGG + Intronic
967566715 3:190981054-190981076 ATGAAGAAGTATTTGAGACTGGG - Intergenic
967906102 3:194501639-194501661 ATAAAAAGGTATTGGTGGCTGGG + Intergenic
968280046 3:197469643-197469665 ATGAAGAGATGTTGGTTAATGGG + Intergenic
969248208 4:5949550-5949572 ATGAAGAGTTACTGTTTAATGGG + Intronic
969909539 4:10430819-10430841 ATGAAGACAGATTGGTTAGTTGG - Intergenic
970094240 4:12444456-12444478 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
971398196 4:26250124-26250146 ATGAGGAAGTATTGCTTAATGGG - Intronic
971468463 4:26991439-26991461 ATGAAGAGAAGTTGGTTAATGGG + Intronic
971512164 4:27440138-27440160 ATAAAGAGATATTGATTAATGGG + Intergenic
971627907 4:28947182-28947204 AAGATGAGGTATTGTTTATTAGG + Intergenic
971855808 4:32042149-32042171 ATGAAGAAGTGTTAGTTAATGGG - Intergenic
973176906 4:47217957-47217979 ATGAAGAAAGATTGGTTAATGGG - Intronic
973185128 4:47317886-47317908 ACCAAGAGGGATTTGTTACTGGG - Intronic
974291298 4:59934440-59934462 AGAAAGATGTAGTGGTTACTAGG - Intergenic
974622554 4:64379606-64379628 ATGAAGAGGGGTTAGTTAATGGG - Intronic
974632256 4:64508208-64508230 ATGAGGTGTTATTGGTTAATGGG + Intergenic
975388702 4:73790079-73790101 ATGGAGAGTTATTGTTTAATGGG - Intergenic
975457739 4:74612397-74612419 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
975488528 4:74962767-74962789 ATGAAGAGTTATTCTTTAATGGG + Intronic
975503092 4:75109134-75109156 ATGAAGAGATATTAGATACCAGG - Intergenic
975507218 4:75150790-75150812 ATAAAGAGTTGTTGGTTAATGGG - Intergenic
975656591 4:76647285-76647307 ATGAAGAGATGTTGGTTAATGGG + Intronic
976193722 4:82513394-82513416 ATGAGGAGGTATTGTTTAATGGG + Intronic
976498086 4:85754039-85754061 ATGAAGAGAAATTGGTTAAGGGG - Intronic
976564056 4:86533258-86533280 ATGAAGAGTTATTGTTTAATGGG + Intronic
976741729 4:88363735-88363757 ATGAATAAGTTTTGGTTAATTGG + Intergenic
976952113 4:90846695-90846717 ATGAAGACGGGTTGGTTAATGGG - Intronic
977331537 4:95643104-95643126 TTGAACAGCTATTGTTTACTGGG + Intergenic
977943320 4:102881299-102881321 ATGAAGAGAGGTTGGTTAATGGG + Intronic
978142480 4:105333348-105333370 ATGAAGAGAAGTTGGTTAATGGG + Intergenic
978582343 4:110244679-110244701 AGGAAGAGATAGGGGTTACTTGG + Intergenic
979020188 4:115487814-115487836 ATTAAGAGGTATTTGTTAAAGGG - Intergenic
979174770 4:117650114-117650136 ATGAATAGTTAATGGATACTGGG + Intergenic
979489214 4:121306130-121306152 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
979730893 4:124021534-124021556 ATGAAGAGATACTGGAGACTGGG + Intergenic
979955063 4:126942491-126942513 ATGGAGAGTTATTTGTTAATCGG + Intergenic
980517698 4:133886007-133886029 ATAGAGAGGTGTTGGTTAATGGG + Intergenic
980693313 4:136323727-136323749 ATAAAGAGAAATTGGTTAATGGG + Intergenic
981253530 4:142632457-142632479 ATGAAGAGAGATTGATTAATGGG + Intronic
981591240 4:146364643-146364665 ATAAAGAGGGATTGGTTAACAGG + Intronic
981642138 4:146956967-146956989 ATGAAGAGGAAATGGTTAAGTGG - Intergenic
981895282 4:149791548-149791570 ATAAAGAGGGAATGGTTAGTGGG - Intergenic
981896419 4:149806451-149806473 ATGAAGGGAGATTGGTTAATGGG - Intergenic
982040987 4:151396274-151396296 ATGAAGAGAGATTAGTTAATGGG + Intergenic
982998767 4:162384935-162384957 ATAAAGAGATATTGATTAATGGG + Intergenic
983299847 4:165911160-165911182 ATGAATAGAGATTGGTTAATGGG - Intronic
983336343 4:166398285-166398307 ATTTACAGGTATTGGTGACTAGG - Intergenic
983408339 4:167362110-167362132 AAGAATAGGTACTGGGTACTGGG - Intergenic
983474130 4:168194023-168194045 ATAAAGAGATGTTGGTTAATGGG + Intergenic
983655185 4:170075726-170075748 ATGGAGAGTTATTGATTAATAGG - Intronic
984897152 4:184551464-184551486 ATGAAGAGCTATTGTTTAATGGG - Intergenic
985944758 5:3170511-3170533 ATGAAGAAGAATTGATTAATGGG - Intergenic
986160054 5:5219356-5219378 ATAAAGAGGAGTTGGTTAATGGG - Intronic
986411319 5:7483032-7483054 ATGAAGAGACATTGGTTAATGGG + Intronic
986887000 5:12251044-12251066 ATGAAAAGGAAGTGGTTATTTGG + Intergenic
986960748 5:13208601-13208623 ATAAAGAGGGGTTGGTTAATGGG + Intergenic
987156568 5:15095578-15095600 ATGAGGAGTTATTGTTTAATGGG - Intergenic
987544433 5:19294625-19294647 ATGAAGAGAGATTGGTTAATGGG - Intergenic
988704818 5:33714815-33714837 ATGAAGAGAAGTTGGTTAATGGG + Intronic
989234515 5:39130279-39130301 ATGAAGAGAGATTGGTGAATGGG + Intronic
989248889 5:39284572-39284594 ATAAAGAGGAGTTGGTTAATGGG - Exonic
989316397 5:40084440-40084462 ATGATGAGTTATTGATTACTGGG + Intergenic
989373095 5:40730574-40730596 ATGAGGAGTTATTGTTTAATGGG - Intronic
989395663 5:40953304-40953326 ATGAAGAGAGATTGCTTAATGGG + Intronic
989560862 5:42849273-42849295 ATGAAGAGTTACTGTTTAATAGG + Intronic
991519349 5:67478423-67478445 ATGATGAGAAATTGGTTAATGGG - Intergenic
991656251 5:68906563-68906585 ATGAGGAGTTATTGTTTAATGGG - Intergenic
992257924 5:74940599-74940621 ATGATGAGGAATTAGTTAATGGG + Intergenic
992525109 5:77602083-77602105 ATGAAGAGAGGTTGGTTAATGGG - Intronic
992734019 5:79700923-79700945 ATGAAGAGAGATTGATTAATGGG + Intronic
993051013 5:82925959-82925981 ATGAAGAGGTAGAGGCTACCTGG - Intergenic
993345856 5:86781277-86781299 ATGAAGAGAACTTGGTTAATGGG + Intergenic
993362531 5:86996023-86996045 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
993489910 5:88534382-88534404 ATGGAGAGTTATTGTTTAATGGG + Intergenic
993642317 5:90420186-90420208 ATGGAGAGTTATTGTTTAATGGG + Intergenic
994130594 5:96223137-96223159 ATGAAGAGATGTTGGTGAATGGG + Intergenic
994334150 5:98544764-98544786 ATGAAGAGAAGTTGGTTAATGGG - Intergenic
994385907 5:99131411-99131433 ATGAGGAGTTATTGTTTAATGGG - Intergenic
994559966 5:101356072-101356094 AGGAAGAGGTATTAATTCCTAGG - Intergenic
995076336 5:107989262-107989284 ATGAAGAGAGGTTGGTTAATAGG - Intronic
995455789 5:112350599-112350621 ATGAAGAGAGATAGGTTAATGGG - Intronic
995986975 5:118188593-118188615 ATGAAGACAGATTGGTTAATGGG + Intergenic
996411859 5:123167279-123167301 ATGAAGAGAGATTGATTAATGGG - Intronic
996576950 5:124986151-124986173 ATGGGGAGGTATTGTTTAATGGG - Intergenic
997946373 5:138205549-138205571 ATGGAGAGTTATTGTTTAATGGG + Intronic
1000572430 5:162931631-162931653 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1001092915 5:168754499-168754521 ATGAAGAGAGGTTGGTTAATGGG + Intronic
1001860512 5:175050217-175050239 ATGGGGAGGTGTTGTTTACTGGG + Intergenic
1003326413 6:5094851-5094873 ATGAAGAGGAGTTGGTTAATGGG + Intergenic
1003711341 6:8594196-8594218 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
1004732354 6:18370224-18370246 ATGAAGAGCTATTGGTCAGGTGG + Intergenic
1004815899 6:19311408-19311430 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
1004979726 6:21009858-21009880 ATGAAGAGAGATTGGTTAAGGGG + Intronic
1005062531 6:21790363-21790385 ATGAAGAGTTAGTGTTTAATGGG - Intergenic
1005324619 6:24687188-24687210 ATGGAGAGTTATTGTTTAATGGG - Intronic
1005798465 6:29392471-29392493 ATGAAGAAGGAATGGTTAGTCGG + Intronic
1006117220 6:31781739-31781761 ATGAGGATGTATTGGATACCTGG - Exonic
1006693553 6:35911412-35911434 ATGATGAGAAAGTGGTTACTTGG + Intronic
1008028159 6:46662508-46662530 AAAGAGAGGTATTGGTTAATTGG - Intronic
1008394234 6:50988578-50988600 ATGAAGAGAAGTTGGTTAATGGG + Intergenic
1008653922 6:53591741-53591763 ATGAAGAGAAGTTGGTTAATGGG - Intronic
1009636464 6:66271281-66271303 ATGAAGAGAAGTTGGTTAATGGG + Intergenic
1010246606 6:73665376-73665398 ATGAAGAGAAGTTGGTTAATGGG + Intergenic
1010254463 6:73742154-73742176 ATGGAGAGTTATTGTTTAATAGG - Intronic
1010306447 6:74328757-74328779 ATGAAGAGAAGTTGGTTAATGGG - Intergenic
1010475153 6:76277513-76277535 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1010731471 6:79395900-79395922 ATGAAGAGGCAGTGGCTACAGGG - Intergenic
1010805827 6:80235030-80235052 ATGAAGAGAGGTTGGTTAATGGG + Intronic
1011127831 6:84025680-84025702 ATAAAGAGGAGTTGGTTAATGGG + Intergenic
1011402921 6:86983534-86983556 ATGACGAGGGGTTGGTTAATGGG + Intronic
1012012997 6:93815269-93815291 ATGAAGAGAAATTAATTACTGGG + Intergenic
1012233636 6:96788124-96788146 AGGAAGAGGAATTGGTTAACAGG - Intergenic
1012336430 6:98064545-98064567 ATAAAGAGCTGTTGGTTAATAGG + Intergenic
1012491228 6:99784354-99784376 ATGAAGTGGTAATGGGCACTTGG + Intergenic
1012562758 6:100604986-100605008 AGAAAGGGGTAGTGGTTACTGGG + Intronic
1012739109 6:102991482-102991504 ATAAAGAGGGTTTGGTTAATGGG + Intergenic
1012746577 6:103098247-103098269 ATGAAGAGAATTTGGTTACTGGG - Intergenic
1012935918 6:105366953-105366975 ATGAAGAGTTATTGTTCACAGGG + Intronic
1013214318 6:108013634-108013656 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
1013965242 6:115947948-115947970 ATCAGGAGGTACTGGTAACTGGG - Intronic
1014059587 6:117055352-117055374 ATGAAGAGAAGTTGGTTAATGGG - Intergenic
1014222121 6:118808337-118808359 ATGAAGAAGTAATGATTAGTGGG + Intergenic
1014549722 6:122776536-122776558 ATGAAGAGGGAATGGTTAATGGG + Intergenic
1014966471 6:127759692-127759714 GTGAAGAGGGAGTGGTGACTTGG - Intronic
1015147936 6:130008223-130008245 ATGAAGAGTTATTGTTTAATAGG - Intergenic
1015186169 6:130419038-130419060 ATGTAGAAGTGTTGGTTAATGGG - Intronic
1017638847 6:156470761-156470783 ATGAAGAGGGGTTGCTTAATGGG + Intergenic
1017897736 6:158695672-158695694 ATGGAGAGTTATTGTTTAATGGG - Intronic
1018034787 6:159872825-159872847 ATGGGGAGGTATTGTTTAATGGG + Intergenic
1018418004 6:163618012-163618034 AAGAAGAACTATTGGGTACTAGG - Intergenic
1020104168 7:5413449-5413471 ATTAGGAGGTGTTGGTTACCAGG - Intronic
1020376954 7:7498472-7498494 ATGGGGAGTTATTGGTTAATGGG + Intronic
1020562831 7:9752409-9752431 ATGAAGAGCTATTGGTTAATGGG - Intergenic
1020758178 7:12232033-12232055 ATGAAGAGGTATTTCCTAATAGG + Exonic
1021119921 7:16787807-16787829 ATGAGGAGTTATTGCTTAATGGG - Intergenic
1021309699 7:19078613-19078635 ATGAAGAGAGGTTGGTTAATGGG + Intronic
1021743874 7:23717941-23717963 ATGAGGAGTTATTGATTAATGGG + Intronic
1022387200 7:29912921-29912943 ATTGAGAGGTATTGTTTAATGGG + Intronic
1022610926 7:31872248-31872270 ATAAAGAGGGATTGGTTAATGGG + Intronic
1022995598 7:35752147-35752169 ATGAAGAGAGATTGATTAATGGG - Intergenic
1023049344 7:36237475-36237497 ATGGAGAGGTATTGTTTAAAAGG - Intronic
1025918930 7:65891928-65891950 ATAAAGAGGGATTGGTGACTGGG - Intronic
1026358257 7:69578857-69578879 ATGAGGAGTTATTGTTTAATGGG + Intergenic
1026512207 7:71037035-71037057 ATGAAGATTTATTGTTTAATGGG - Intergenic
1027898942 7:84083576-84083598 ATGAAGAGGGAATGGTTAATGGG - Intronic
1027931424 7:84539915-84539937 ACCAAGAGGTATTGTTTACCAGG + Intergenic
1028569605 7:92272026-92272048 ATGAAGAGCTAGTGCTTAATGGG + Intronic
1028938457 7:96492210-96492232 ATGGAGAGTTATTGTTTAATGGG - Intronic
1028960720 7:96747135-96747157 ATGAAGTGGTATTATTTCCTTGG + Intergenic
1029021852 7:97372438-97372460 ATGAAGAGCTATTGTTTAATAGG - Intergenic
1030335312 7:108318990-108319012 ATGAAGAGTCATTGTTTAATGGG + Intronic
1030841363 7:114358319-114358341 ATGAAGAAATATTGGAGACTGGG - Intronic
1030994507 7:116342281-116342303 ATGAGGAGTTATTGCTTAATGGG - Intronic
1031313782 7:120231881-120231903 ATGAAGAATTATTGGATACAGGG + Intergenic
1031565114 7:123286776-123286798 ATGAAGAGGGGTTTGTTAATGGG - Intergenic
1031733199 7:125323247-125323269 ATGAGGAGGGATTGGTTAACGGG - Intergenic
1032318652 7:130864779-130864801 ATGAAGAGAAGTTGGTTAATGGG + Intergenic
1032900189 7:136298378-136298400 ATGAAGAGAAGTTGGTTAATGGG + Intergenic
1032951056 7:136913558-136913580 GTGATTAGGTATTGGTTATTAGG - Intronic
1033447319 7:141434747-141434769 ATGAAGAAAGATTGGTTAATGGG - Intronic
1033604488 7:142915897-142915919 AGGAAGAGGTATTAGTGGCTTGG + Intronic
1033797017 7:144857628-144857650 ATGACCAGTTATTGTTTACTGGG - Intergenic
1034684190 7:152955268-152955290 ATGGAGAGATATTGGTCACCTGG + Intergenic
1034773042 7:153798328-153798350 AAGAAGAGATATTGGTTCTTTGG + Intergenic
1034917666 7:155054305-155054327 AAGAAGAGCTAATGGATACTGGG - Intergenic
1036116342 8:5964406-5964428 ATGAAGAGAAGTTGGTTAATGGG - Intergenic
1037101144 8:15048346-15048368 ATGAAGAGAGGTTGGTTAATGGG + Intronic
1037558346 8:20049029-20049051 AGGAAGAGGAATTGGTCAATAGG - Intergenic
1037697612 8:21239516-21239538 ATGTAGAGGTATTGGCTAATGGG - Intergenic
1038065456 8:23959139-23959161 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1038250646 8:25900844-25900866 ATGAAGAGAGGTTGGTTAATGGG + Intronic
1039577864 8:38639096-38639118 ATAAAGAGTTATTGTTTAATGGG + Intergenic
1039835311 8:41251399-41251421 ATGAGGAGTTATTGTTTAATGGG - Intergenic
1040362150 8:46676094-46676116 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
1040662418 8:49590049-49590071 AAGAAGAGGTATTCCTTAATGGG + Intergenic
1041034870 8:53778457-53778479 ATGAAGTGAGATTGGTTAATGGG - Intronic
1041163158 8:55065392-55065414 ATTAACGGGTATTGGTTTCTGGG + Intergenic
1041253290 8:55955662-55955684 ATGAAGAGTGATTGTTTATTGGG - Intronic
1042903777 8:73752879-73752901 ATGAAGAGGGATTGGTTAATGGG + Intronic
1043148839 8:76687406-76687428 ATGAAGAGGACATTGTTACTAGG + Intronic
1044047154 8:87450323-87450345 ATGAAGAGAGGTTGGTTAATGGG + Intronic
1045048808 8:98304337-98304359 ATGAAGAGAGGTTGGTTAATAGG - Intergenic
1045065536 8:98440487-98440509 ATGAGGAACTATTGTTTACTGGG - Intronic
1045376554 8:101580427-101580449 ATGAAGAGAGGTTGGTTAATGGG - Intronic
1045532440 8:102997712-102997734 ATGAAGAGAAATTGGTTAAGGGG - Intergenic
1045543691 8:103109559-103109581 ATGAAGAAGGATTGGTGAATGGG + Intergenic
1045622670 8:104000174-104000196 ATGAAGAGGGGTTGGTTAATGGG - Intronic
1046120856 8:109844973-109844995 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1046209410 8:111048035-111048057 ATGAAGAGAGCTTGGTTAATGGG + Intergenic
1046306807 8:112378670-112378692 ATGAAGAGAGGTTGGTTAATGGG + Intronic
1047547226 8:125830320-125830342 ATGAAGAGATGTTGGTTATATGG - Intergenic
1047981617 8:130189285-130189307 ATAAAGAGGGATTGGTTATTAGG - Intronic
1048152629 8:131909106-131909128 ATGAAGAGAGGTTGGTTAATAGG - Intronic
1048621944 8:136143352-136143374 ATGAGTAGGTATTTCTTACTGGG + Intergenic
1049841061 8:144772320-144772342 ATGAAGAGTTATTATTTAATAGG + Intergenic
1050162263 9:2731068-2731090 ATGAAGAGGAAAAGGTTACAGGG - Intronic
1050380471 9:5023130-5023152 ATGAAGAGATGTTGGTTAATGGG - Intronic
1050397047 9:5209884-5209906 ATGAACAGATGTTGGTTAATGGG + Intergenic
1050754803 9:8989332-8989354 ATGAAGAGAAATTGGTTAAGGGG - Intronic
1050866788 9:10510824-10510846 ATGAAGAAGGGTTGGTTAATAGG - Intronic
1050877493 9:10656926-10656948 ATGAAGAGAGCTTGGTTAATGGG + Intergenic
1051073139 9:13197725-13197747 ATGAAGAGGTATTGGTTACTGGG - Intronic
1051156482 9:14152887-14152909 ATGAAGAGAGATTGGTTAATGGG + Intronic
1052114377 9:24631784-24631806 ATGAAGAGATATTGGTTAAAGGG - Intergenic
1052476257 9:28963796-28963818 ATGAATAGAGATTGGTTAATGGG + Intergenic
1052782901 9:32798889-32798911 ATAAAGAGTCATTGGTTAATGGG + Intergenic
1053231163 9:36410884-36410906 ATGAGGAGTTATTGTTTAATGGG + Intronic
1054809414 9:69423012-69423034 ATGAAGAGTTATTGTTAAGTAGG - Intergenic
1054886587 9:70205309-70205331 ATGAGGAGTTATTGTTTAATGGG - Intronic
1054896516 9:70319210-70319232 TTGAAGAGGTTTTGTTTACATGG + Intronic
1054915016 9:70487457-70487479 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
1055310554 9:74975026-74975048 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
1055356203 9:75439387-75439409 ATGGAGAGTTATTGTTTAATGGG + Intergenic
1055413912 9:76062922-76062944 ATGAGGAGGCATTGGGTAATAGG - Intronic
1055653972 9:78435549-78435571 ATAAAGAGTTATTGGTCAGTGGG + Intergenic
1056181846 9:84091900-84091922 ATGAAGAGATGTTGGTAAATGGG - Intergenic
1056187401 9:84149103-84149125 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1056286755 9:85094856-85094878 ATGGAGAGTTATTGTTTAATGGG + Intergenic
1057528273 9:95821764-95821786 AGGAAGATGTATTGGTTGTTTGG - Intergenic
1057980425 9:99656027-99656049 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
1058086977 9:100758412-100758434 ATAAGGAGAGATTGGTTACTGGG - Intergenic
1059954080 9:119497983-119498005 ATGAAGAAGTGTTGGTTAATGGG - Intronic
1060571996 9:124650457-124650479 ATGAAGAGAGGTTGGTTAATAGG + Intronic
1060708164 9:125827000-125827022 ATAAAGAGGGATTGGTTAATGGG - Intronic
1061457636 9:130710816-130710838 TTCAAGAGGAATTAGTTACTTGG - Intergenic
1061749534 9:132767967-132767989 GTGAAGAGAGGTTGGTTACTGGG + Intronic
1061956848 9:133968067-133968089 GTGAAGAGAGATTGGTTAATGGG + Intronic
1185916341 X:4039634-4039656 ATGAAGAGAAGTTGGTTAATAGG + Intergenic
1187894864 X:23971288-23971310 ATGAAGAGAGGTTGGTTATTGGG - Intergenic
1187968130 X:24632797-24632819 ATGAAGAGAGGTTGGTTACTGGG + Intronic
1188082836 X:25865423-25865445 ATGAAGAGAGATTGGTTAATAGG + Intergenic
1188144617 X:26595658-26595680 ATGAGGAGGGGTTGGTTAATGGG + Intergenic
1188177324 X:27007070-27007092 ATGAAGAGAAGTTGGTTAGTTGG + Intergenic
1188391147 X:29621896-29621918 ATAAAGAGAGATTGGTTAATGGG - Intronic
1188451828 X:30315594-30315616 ATGAAGAGAGATTGGTTAATTGG - Intergenic
1188495795 X:30781781-30781803 AAGAATAGCTATTGGGTACTGGG - Intergenic
1188628774 X:32324012-32324034 GTGAAGAGAGATTGGTTACTGGG + Intronic
1188754994 X:33951631-33951653 ATGAAAAGAAATTGGTTAATGGG + Intergenic
1189108280 X:38259278-38259300 ATGAAGAGAGGTTGGTTAATGGG - Intronic
1189685427 X:43559262-43559284 ATGAGGAGTTATTGTTTAATGGG + Intergenic
1189686504 X:43569491-43569513 ATGAAGAGAAATTGGTTAAAGGG + Intergenic
1190294801 X:49019742-49019764 ATGGAGAGTTATTGCTTAATGGG - Intergenic
1190383008 X:49857656-49857678 ATGACGAGTTAATGGTTAATGGG - Intergenic
1190482957 X:50895839-50895861 ATGAAGAGCAATTGGTTAATGGG + Intergenic
1191041667 X:56087874-56087896 ATAAATAGTTATTGGTTAATTGG + Intergenic
1191139671 X:57103585-57103607 CTAAAGAGGTACTGGGTACTGGG + Intergenic
1191686516 X:63898149-63898171 ATGAAGAGGGGTTGGTTGATGGG + Intergenic
1191989805 X:67022179-67022201 ATGGAGAGATATTGGTCAATGGG - Intergenic
1192187748 X:68964279-68964301 ATAAAGAGGGATTGGTTAATGGG - Intergenic
1192268072 X:69554012-69554034 ATGCAGAGGTATTGTTGAATGGG + Intergenic
1192348762 X:70336884-70336906 ATGAGGAGTTATTGTTTAGTGGG - Intronic
1192938827 X:75891647-75891669 ATGAAGAGATGTTGGTTAATGGG + Intergenic
1193055735 X:77147774-77147796 ATGAAGAGACATTGGTTAATAGG + Intergenic
1193535493 X:82710212-82710234 ATAAGGGGTTATTGGTTACTAGG + Intergenic
1193655584 X:84193174-84193196 GTGAAGGGGTGTTGGTTAATGGG - Intergenic
1194349016 X:92802663-92802685 ATAAAGAGAAATTGGTTAATGGG + Intergenic
1194453899 X:94079109-94079131 ATAAAGAGAAATTGGTTAATGGG + Intergenic
1194806812 X:98339303-98339325 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1194859843 X:98984240-98984262 ATGAAGAGAGGTTGGTTAATAGG + Intergenic
1195057206 X:101157924-101157946 ATGAAGAGAGGTTGGTTAATGGG - Intronic
1195344304 X:103934111-103934133 ATGAAGAGAGATTGGTTAATGGG - Intronic
1195362650 X:104099134-104099156 ATGAAGAGAGATTGGTTAATGGG + Intergenic
1195484127 X:105383229-105383251 ATAAAGAGGGGTTGGTTAATGGG - Intronic
1195596082 X:106691495-106691517 ATGAAGAGAAGTTGGTTAATGGG - Intergenic
1195801044 X:108710951-108710973 ATGGAGAGTTATTGTTTAATGGG - Intergenic
1195839876 X:109162978-109163000 ATGAAGAGCGGTTGGTTAATGGG - Intergenic
1195973072 X:110494986-110495008 ATGATGAGGGATTAGATACTTGG + Intergenic
1196055835 X:111354062-111354084 ATGAACAGTAACTGGTTACTGGG + Intronic
1196089577 X:111725484-111725506 ATAAAGAGGGATTAGTTAATGGG + Intronic
1196134503 X:112193406-112193428 ATAAATAGGGATTGGTTAATGGG - Intergenic
1196240044 X:113332834-113332856 ATGAAGAGAAGTTGGTTAATGGG - Intergenic
1196560126 X:117136461-117136483 ATGAAGAGAGGTTGGTTAGTGGG - Intergenic
1196707947 X:118732187-118732209 ATGAGGAGTTATTGTTTAATGGG - Intronic
1196883193 X:120219025-120219047 ATGAAGAGAAGTTGGTTAATGGG + Intergenic
1196921392 X:120589147-120589169 ATGAAGAAAGATTGGTTAATGGG + Intergenic
1196941307 X:120778721-120778743 ATGAATAGGTAATGGATGCTGGG + Intergenic
1197105833 X:122714253-122714275 ATAAAGAGGGAATGGTTAATGGG + Intergenic
1197553583 X:127926023-127926045 ATGAAGAGAGGTTGGTTAATGGG + Intergenic
1197684011 X:129419355-129419377 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1198171548 X:134110792-134110814 ATGAAGAGAGGTTGGTTAATGGG - Intergenic
1198338732 X:135693182-135693204 AACAACAGGTAATGGTTACTGGG + Intergenic
1198547814 X:137711667-137711689 ATGGAGAGTTATTGTTTAATGGG + Intergenic
1198798889 X:140429587-140429609 ATGAAGTGGGAATGGTTAATGGG + Intergenic
1199192316 X:144984411-144984433 ATGAAAAGAGGTTGGTTACTGGG + Intergenic
1199842976 X:151669516-151669538 ATGAAGAGAAGTTGATTACTGGG - Intronic