ID: 1051073140

View in Genome Browser
Species Human (GRCh38)
Location 9:13197726-13197748
Sequence GATGAAGAGGTATTGGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 1, 2: 6, 3: 52, 4: 467}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051073140_1051073149 9 Left 1051073140 9:13197726-13197748 CCAGTAACCAATACCTCTTCATC 0: 1
1: 1
2: 6
3: 52
4: 467
Right 1051073149 9:13197758-13197780 CTCAAACTCTTCCAAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051073140 Original CRISPR GATGAAGAGGTATTGGTTAC TGG (reversed) Intronic
900648329 1:3718876-3718898 GGTGAGGAGGTGTTGGTTGCGGG - Intronic
901176567 1:7304072-7304094 GATGAAGAGTTATTGCTTAAAGG + Intronic
901898326 1:12334944-12334966 GAAGAAGAATTATTGGTTTCTGG - Intronic
902390170 1:16099093-16099115 GATGAACAGGTGGAGGTTACTGG - Intergenic
902787282 1:18741003-18741025 GATGAAGAGAGGTTGGTTAATGG + Intronic
904633654 1:31862579-31862601 GACCAAGTGGTATTAGTTACAGG + Intergenic
906284124 1:44575151-44575173 GATGAAGAGAGGTTGGTTAATGG - Intronic
906611132 1:47204260-47204282 GATGAAGAGAGGTTGGTTAATGG + Intergenic
906927934 1:50138847-50138869 AATGAGGAGGTATTGTTTAATGG + Intronic
908345734 1:63230438-63230460 AATGAAGAGTTATTGTTTAGTGG - Intergenic
908570080 1:65400454-65400476 GATGAGGAGGCATTGGTTAAAGG - Intronic
909101246 1:71352167-71352189 GATGAAGAGAGGTTGGTTAAAGG - Intergenic
910373349 1:86542151-86542173 GATGAAGAGAGGTTGGTTAATGG + Intergenic
910751090 1:90631768-90631790 TATGAGGAGGTATTGGTCAAAGG + Intergenic
911238582 1:95439382-95439404 GATGAAGAGAAGTTGGTTAATGG - Intergenic
911238958 1:95443953-95443975 GATAAAGAGGGGTTGGTTAATGG - Intergenic
911837543 1:102640528-102640550 GATAAAGAGAAGTTGGTTACTGG - Intergenic
912178546 1:107190167-107190189 AATGAAGAGTTATTGTTTAATGG + Intronic
912639014 1:111326272-111326294 GATGAAGAGAGATAGGTTAACGG - Intergenic
913035237 1:114958305-114958327 GATGAAGAGGGATTGATTAATGG + Intronic
913043028 1:115047397-115047419 GATGAAGAGGGATTGATTACTGG + Intergenic
913567609 1:120088536-120088558 GAAGAATAGCTAATGGTTACTGG - Intergenic
913720839 1:121592728-121592750 GAAGAAGAGTAATTGGTTAATGG + Intergenic
914354654 1:146873790-146873812 GATGAAAGGGCAATGGTTACGGG + Intergenic
915537324 1:156544727-156544749 TGTGAAGAGGTGTTGGTTAGAGG - Intronic
916732752 1:167581072-167581094 GGTGAAGAGGCAGAGGTTACAGG + Intergenic
916919453 1:169448446-169448468 GATGTAGAATTATAGGTTACAGG + Intronic
916954800 1:169820678-169820700 GATGAAGAGGATTGGGTTAGAGG - Intronic
917261038 1:173169760-173169782 GATGAAGAGAGGTTGGTTAATGG + Intergenic
918196303 1:182225557-182225579 GATAAAGAGGGATTGGCTAATGG - Intergenic
918787480 1:188781304-188781326 GATTATGATGTAATGGTTACTGG - Intergenic
919066989 1:192704785-192704807 GATGAAGAGAAGTTGGTTAATGG - Intergenic
919367592 1:196683833-196683855 GATGAAGAGGCAATTGTTTCAGG + Intronic
920131077 1:203732286-203732308 GAGGAAGAGGTTTTGGTTGGTGG - Intronic
920616145 1:207494781-207494803 GATGGAGAGAGATTGGTTAAAGG + Intergenic
920632718 1:207668533-207668555 GATGGAGAGAGATTGGTTAAAGG + Intronic
920829826 1:209454066-209454088 GATGAAGAGGGGTTGGTTAATGG - Intergenic
921147655 1:212374433-212374455 GATGAAGAGAAATTGGTTAATGG + Intronic
921290096 1:213649293-213649315 GATGATCAGGCATTAGTTACTGG - Intergenic
921468065 1:215515227-215515249 GATGAAGAGAGGTTGGTTAATGG + Intergenic
922773543 1:228203808-228203830 GATGAAGAGGGGCTGGTTAATGG + Exonic
923778520 1:237000747-237000769 GATGAAGAGCGGTTGGTTATGGG + Intergenic
924210474 1:241760969-241760991 CAAGAAGAGGGATTGGTTGCTGG + Intronic
1064334950 10:14431240-14431262 GATGAAGAGAAGTTGGTTAATGG + Intronic
1064373105 10:14771347-14771369 CATTAAGAGGAGTTGGTTACTGG + Intronic
1065501788 10:26390537-26390559 GATGAAGAGAGGTTGGTTAATGG + Intergenic
1065618000 10:27548567-27548589 GATGAAGAGAAGTTGGTTAAGGG + Intergenic
1065734879 10:28742563-28742585 AATGAGGAGCTATTGGTTAAGGG + Intergenic
1065994541 10:31045199-31045221 GATGAAGAGAGGTTGGTTAATGG - Intergenic
1066527156 10:36294369-36294391 GATGAAGAGAGATAGGTTAATGG - Intergenic
1066589306 10:36976271-36976293 GACAAAGAGGGATTGGTTAATGG + Intergenic
1067283767 10:44892609-44892631 GATGAAGAGGGATCGGTCAATGG - Intergenic
1067351898 10:45483921-45483943 GATAAAGAGAGATTGGTTAATGG + Intronic
1067688470 10:48482904-48482926 GATGAAGAGAGGTTGGTTAATGG - Intronic
1067974216 10:51005949-51005971 GATGTAGAGATATGGGTTAGGGG + Intronic
1068272054 10:54740886-54740908 GATGAAGAAAGATTGGTTAATGG + Intronic
1070432480 10:76354929-76354951 GATGAAGAGAGGCTGGTTACGGG - Intronic
1071741480 10:88363275-88363297 GATGAAGAGCTAATGGATGCTGG + Intronic
1071774600 10:88771381-88771403 GATAAAGAGGCATTGGTTAATGG - Intronic
1072380949 10:94869525-94869547 GATCAAGTGGGATTGGTTCCAGG + Intergenic
1074009105 10:109458404-109458426 AATGAAGAGATGTTGGTTAAAGG - Intergenic
1074127246 10:110538716-110538738 GATGAAGAGAAATTGATTAATGG + Intergenic
1075133526 10:119761946-119761968 GAAGAGGAGGGATTGGTTCCAGG + Intronic
1076003734 10:126931752-126931774 GATGAAGACACATTGGTTCCTGG - Intronic
1076351835 10:129821144-129821166 GATGGAGAGTTATTGTTTAAAGG - Intergenic
1077693010 11:4365729-4365751 GATGGAGAGATGTTGGTCACAGG + Intergenic
1077726322 11:4678649-4678671 GATGGAGAGTTATTGTTTATGGG - Intergenic
1077786233 11:5386753-5386775 GATGAAGATGAATAGATTACAGG + Intronic
1079202898 11:18390626-18390648 GATGAAGAGGGATTGGTTAATGG - Intergenic
1079275224 11:19029148-19029170 GATGAAGAGGGGTTGGCTAATGG + Intergenic
1079812543 11:25013240-25013262 GATGAAGAGGAGTGGGTTAATGG + Intronic
1079919800 11:26418808-26418830 AATGAAGAGGCATAGATTACAGG + Intronic
1080002526 11:27365512-27365534 AATGAAGAGGCATTGGGTTCTGG + Intergenic
1081105366 11:39060862-39060884 GATGAAGAGCAGTTGGTTAATGG - Intergenic
1081540895 11:44033845-44033867 TTTGAAGAGGTATTGGATGCTGG + Intergenic
1082207950 11:49461643-49461665 GATGAATAGCTAATGGGTACTGG - Intergenic
1082755476 11:57071558-57071580 GTTGAAGAGGTATGGGTCAATGG + Intergenic
1082804813 11:57441070-57441092 GATGAAGAAGTATGGGCCACGGG - Intergenic
1084658051 11:70530739-70530761 AATGAAGAGCTAGTGTTTACTGG + Intronic
1085062707 11:73462452-73462474 AATGAAGAGTTATTGTTTAATGG + Intronic
1085817351 11:79753595-79753617 GATGAAGAGAGGTTGGTTAATGG + Intergenic
1085830996 11:79900871-79900893 GATGAAGAGAGGTTGGTTAATGG + Intergenic
1086571310 11:88287655-88287677 GATAAAGAGATGTTGGTTAATGG - Intergenic
1086975286 11:93125216-93125238 AATGAAGAGTTATTGTTTAATGG - Intergenic
1087068266 11:94048009-94048031 AATGGAGAGGTATTGATTAATGG - Intronic
1087566040 11:99859423-99859445 GATGCTGAGGTTTGGGTTACGGG + Intronic
1089815486 11:121169985-121170007 GATGAAGAGAGGTTGGTTAATGG - Intronic
1091199712 11:133765530-133765552 GATAAAGAGGGGTTGGTTAATGG + Intergenic
1091252912 11:134158795-134158817 GATGAAGAGAAGTTGGTTAATGG - Intronic
1092039233 12:5368931-5368953 GATGACGAGGAATGGGTCACAGG - Intergenic
1092665025 12:10786634-10786656 AATGAAGAGATATTGGTCAAAGG - Intergenic
1095803730 12:46295619-46295641 GATGAAGAGAGATTGATTAATGG + Intergenic
1096888810 12:54745428-54745450 GATGAAGAGAGGTTGGTTAATGG - Intergenic
1097195624 12:57241134-57241156 TATGATGAGGTCTTGGTGACAGG + Intergenic
1097445959 12:59670920-59670942 GATGCAGAGGTCTTGGTTAAGGG - Intronic
1097460976 12:59861459-59861481 AATGAAGAGACATTGGTTAAAGG - Intergenic
1099192153 12:79571586-79571608 GATTAAGAGGTATTGCTGGCTGG - Intergenic
1099206635 12:79736002-79736024 GATAAAGAGGAATTGGTTAGTGG + Intergenic
1099506727 12:83486787-83486809 GATGAAGAGAGGTTGGTTAGTGG - Intergenic
1099917872 12:88918009-88918031 GATCAAGTGGTATTGGTCATAGG + Intergenic
1100402140 12:94241478-94241500 GATAAAGAGGGTTTGGTTAATGG - Intronic
1100928666 12:99580612-99580634 GGTGAAGAGAAATTGGTTAATGG + Intronic
1101162737 12:101995387-101995409 CATGAAGAGGTATTAGTAGCAGG - Intronic
1102092703 12:110206035-110206057 AATGAAGAGTTATTGCTTAATGG - Intronic
1102200042 12:111050868-111050890 GATGAAGAGAGGTTGGTTAATGG + Intronic
1103211300 12:119168666-119168688 GATGAAGAGGGAATGGCTATTGG - Intergenic
1106368671 13:29109451-29109473 TATGGGGAGGTATTGGTTAAAGG - Intronic
1106784732 13:33095353-33095375 GATAAAGAGAGATTGGTTAATGG - Intergenic
1107535910 13:41331662-41331684 GATGAAGAGAGGTTGGTTAATGG + Intronic
1107607846 13:42079423-42079445 GATGATGAGAAATTGGTTAGTGG - Intronic
1108014578 13:46061039-46061061 GATGAGGAGATATTGCCTACTGG + Intronic
1108118482 13:47157662-47157684 GATGAAGAGAGGTTGGTTAATGG - Intergenic
1108307445 13:49152608-49152630 GATGACGAGTTAGTGGTTAGTGG - Intronic
1108461920 13:50675561-50675583 GGTGATGAGATATTGGTTAGTGG - Intronic
1108564835 13:51685658-51685680 GAAGAAGAGGGGTTGGTTTCAGG + Intronic
1109182920 13:59235307-59235329 GATGAAGAGGGGTTGGTTAATGG - Intergenic
1109228549 13:59726877-59726899 GATGAAGAGGTCCTGGTGAATGG + Intronic
1109479747 13:62934464-62934486 GATGAGGAGGTATTGGTTAACGG - Intergenic
1109725385 13:66334163-66334185 GATGAAGAGAGGTTGGTTAATGG - Intronic
1110011941 13:70347108-70347130 GATGAAGAGGGATTCATTAATGG + Intergenic
1110013300 13:70366279-70366301 GATGAAGAGAGGTTGGTTAATGG + Intergenic
1110330577 13:74267598-74267620 GATGAAGAGAGGTTGGTTAATGG + Intergenic
1110754692 13:79159013-79159035 GATGAAGAGAGGTTGGTTAATGG - Intergenic
1111082637 13:83331615-83331637 GATGAAGAAAGATTGGTTAAGGG + Intergenic
1111114902 13:83762963-83762985 GATGAAGAGATGTTTGTTAATGG + Intergenic
1111114918 13:83763232-83763254 TATGCAGAGGGATTGGTTCCAGG - Intergenic
1111204316 13:84984444-84984466 GATGAAGAGAAATAGATTACTGG + Intergenic
1111260138 13:85726841-85726863 TATGAATAGGTATTGGTGATGGG + Intergenic
1111608476 13:90572260-90572282 GATGAAGACAGATTGGTTAATGG - Intergenic
1112180981 13:97080067-97080089 GATGAAGAGAGGTTGGTTAATGG + Intergenic
1113022056 13:105898090-105898112 GATGAAGAGAAGTTGGTTAAGGG + Intergenic
1113320451 13:109227657-109227679 GATGAAGAGGTAGTAATTATTGG + Intergenic
1114149840 14:20025867-20025889 AATAAAGAGGAATTGGTTAATGG - Intergenic
1115695222 14:35890600-35890622 GATGAAGAGAGGTTGGTTATGGG - Intronic
1116256125 14:42558810-42558832 AATAAAGAGGGATTGGTTAATGG - Intergenic
1117206652 14:53450460-53450482 GATGAGGGAGTATTGCTTACTGG + Intergenic
1118456034 14:65946411-65946433 GATGAAGAGGTATAGGCTGGGGG + Intergenic
1119885002 14:78132844-78132866 GATGCAGAGATATTGGTTAAAGG + Intergenic
1120816208 14:88861609-88861631 GATGAAGAGAAGTTGGTTAAGGG - Intronic
1121828726 14:97031904-97031926 GATAAAGAGAGATTGGTTATTGG + Intergenic
1122149105 14:99715015-99715037 GATGAAGAGAAGTTGGTTAATGG + Intronic
1123509360 15:20981074-20981096 GATGGGGAGATATTGGTTAAAGG - Intergenic
1123882820 15:24691214-24691236 GATGAAGAGGTACTCTTTATAGG - Intergenic
1124034288 15:26039672-26039694 GATGAAAAGGTGTTGCTCACAGG - Intergenic
1124859328 15:33423140-33423162 GATGGAGAGTTATTGCTTAATGG - Intronic
1125315385 15:38425977-38425999 GATGAAGAGAGATTGGTCAATGG + Intergenic
1125710321 15:41780028-41780050 AATGAAGAGGTGTTGGGTCCAGG - Intronic
1126336348 15:47589688-47589710 GAAGTAGAGGTATTGGCTAAGGG + Intronic
1127403765 15:58619346-58619368 GATAAAGAGAGATTGGTTAATGG + Intronic
1128006391 15:64245958-64245980 GATGAAGAGAGCTTGGTTAATGG + Intronic
1129873362 15:78956035-78956057 GATGGAGAGGCAGAGGTTACAGG + Intergenic
1131091161 15:89625765-89625787 GACGAAGAGGTGTTTGTTTCCGG + Exonic
1132475052 16:130883-130905 AATGAAGAGTTATTGGTCAGTGG + Intronic
1133866533 16:9649142-9649164 GATGAAGAGAAATTGGTTAATGG + Intergenic
1134188861 16:12105952-12105974 GATGAAGAGTGATTGCTTCCTGG + Intronic
1134427409 16:14164176-14164198 GATGAAGAGAGATTGGTTAATGG - Intronic
1137459033 16:48641204-48641226 AATGAAGAGATATTGGTTAAAGG - Intergenic
1137793776 16:51197617-51197639 GATGAAGATGTTTTAGTTATTGG + Intergenic
1139660730 16:68419086-68419108 GATGAAGAAGTAGTGGCTAGGGG + Intronic
1139979366 16:70841744-70841766 GATGAAAGGGCAATGGTTACGGG - Intronic
1141500192 16:84438775-84438797 GATTAAGAGTTTTTGGTTCCAGG - Intronic
1143892115 17:10110412-10110434 GATGAAGAGAGTTTGGTTAAGGG + Intronic
1144485065 17:15657520-15657542 AATGAGGAGTTATTGGTTAATGG - Intronic
1145358811 17:22192808-22192830 GATGAGGAGACATTGGTTAATGG + Intergenic
1146570992 17:33952728-33952750 GATGAAGATGTATTGATAATGGG + Intronic
1147058508 17:37853620-37853642 AATGAAGAGTTATTGTTTAATGG + Intergenic
1147349795 17:39832738-39832760 GATGAAGAGAGATTAGTTAATGG + Intronic
1147502598 17:40979760-40979782 GATGAAGAGAGGTTGGTTAATGG + Intronic
1149717308 17:58804988-58805010 GATGAAGAGAGATTGGTCAATGG - Intronic
1151230662 17:72682716-72682738 GGTGAAGAGCTGATGGTTACAGG - Intronic
1152032061 17:77849179-77849201 GATGAAGAGAGGTTGGTTAATGG - Intergenic
1153144513 18:2015368-2015390 GAAGAAGAGGCATTGGTTTAAGG + Intergenic
1154366518 18:13714984-13715006 AGTGAAGATATATTGGTTACTGG + Intronic
1154367909 18:13727716-13727738 GAAGAAGAGAAATTGGTTAATGG - Intronic
1155047909 18:22119343-22119365 GATGAAGACAGATTGGTTAATGG - Intergenic
1155118613 18:22795641-22795663 AATGAAGAGTTATTGTTTAATGG + Intergenic
1155248452 18:23933660-23933682 GATGAAGAGGGGTTGGTTAATGG - Intronic
1155365965 18:25049347-25049369 GCTCAAGAGGTAGTGGTGACTGG - Intergenic
1155662046 18:28260818-28260840 GATGAAGAGAAGTTGGTTAATGG + Intergenic
1156205258 18:34878788-34878810 GATGGAGATGTATTAGTGACTGG - Intronic
1156510303 18:37630910-37630932 GATGAAGGGTTATTGTTTAATGG - Intergenic
1156701945 18:39836188-39836210 GATAATGAGGCATTGGTTTCTGG - Intergenic
1157398063 18:47360202-47360224 GATGAAGAGAGGTTGGTTAATGG - Intergenic
1158503935 18:58029216-58029238 GGTGAAGAGATAGTGGTTAAAGG + Intergenic
1158578042 18:58656812-58656834 GATGGGGAGGTATTGTTTAATGG + Intergenic
1159111657 18:64066092-64066114 GATGAAGAGAGGTTGGTTAATGG - Intergenic
1162229420 19:9253670-9253692 GATGAAGAGAGTTTGGTTAATGG + Intergenic
1163059126 19:14745528-14745550 GATGAAGAGAGGTTGGTTAATGG - Intronic
1164882670 19:31748090-31748112 GATGAGAAGTTATTGTTTACTGG - Intergenic
1166618864 19:44277074-44277096 GATGAAGAGAGGTTGGTTAATGG - Intronic
1167986432 19:53321737-53321759 GATGAAGAGAGGTTGGTTAATGG - Intergenic
925893121 2:8452093-8452115 GAAGTAGAGGTCTTGGTCACGGG - Intergenic
926327979 2:11801619-11801641 GATGAAGAGAGGTTGGTTAATGG + Intronic
927009228 2:18884825-18884847 GATAAAGAGGTATTGGTTAATGG + Intergenic
927035486 2:19170909-19170931 GATGAAGAGAGGTTGGTTAATGG - Intergenic
927734432 2:25506157-25506179 GATGAAGAGAGGTTGGTTAATGG + Intronic
928181915 2:29073960-29073982 GATGAAGAGGTTTTGGTTCCTGG + Exonic
928999676 2:37333920-37333942 AATGTAGAGGTATTGTTTAATGG + Intergenic
929072898 2:38051651-38051673 GATGAAGAGAGGTTGGTTAATGG - Intronic
929953361 2:46434719-46434741 GATGAAGAGGTAGAGGTTCTTGG - Intronic
930592418 2:53343834-53343856 GATGAAGAGAAGTTGGTTAATGG + Intergenic
931089682 2:58872058-58872080 GATTAAGAGGTATCGGTTAGAGG - Intergenic
932066083 2:68562242-68562264 GTTGGAGAGGTATTGGTCAAAGG + Intronic
932491061 2:72121026-72121048 GATGCATAGATATTGGTTATTGG - Intergenic
933359802 2:81267073-81267095 GAGGAAGAGGCTGTGGTTACTGG + Intergenic
933562561 2:83906613-83906635 GATGAAGAGAGGTTGGTTAATGG - Intergenic
933673031 2:85027311-85027333 GACGAAGAGGAACTGGTGACTGG - Intronic
935244793 2:101208816-101208838 GATGAAGAGAGGTTGGTTAATGG - Intronic
935686232 2:105686189-105686211 GATGAAGAGAGGTTGGTTAATGG + Intergenic
935859018 2:107307524-107307546 GGTGAAGAGGGGTTGGTTAAGGG - Intergenic
936149741 2:110008977-110008999 GAAGAAGAAGTATTGGTTGATGG - Intergenic
936194937 2:110362392-110362414 GAAGAAGAAGTATTGGTTGATGG + Intergenic
936735317 2:115434802-115434824 GATGAAGAGAAGTTGGTTAATGG - Intronic
937129861 2:119501490-119501512 GATGAACAGATGTTGGTTAATGG + Intronic
938604674 2:132880166-132880188 GATGAAGAGACATTGGTCAATGG + Intronic
938676784 2:133643915-133643937 GTTGAAGAGGTAAAGGTTTCAGG - Intergenic
939058249 2:137388637-137388659 GATGAAGAGAGGTTGGTTAATGG - Intronic
940316533 2:152333386-152333408 GAGAAAAAGGTCTTGGTTACTGG + Intergenic
940431708 2:153599361-153599383 GATGAAGAGAGATTGATTAATGG - Intergenic
940763115 2:157760320-157760342 GATGAAGAGACGTTGGTTAATGG + Intronic
941099022 2:161276815-161276837 GATAAAGAGGGATTGGTTAATGG - Intergenic
941583095 2:167324833-167324855 GATGAAGAGAGGTTGGTTAATGG - Intergenic
943138293 2:183943917-183943939 GATAAAGAGGGATTGGTTGATGG + Intergenic
943175658 2:184470093-184470115 GATGAAGAGAAGTTGGTTAATGG + Intergenic
943225061 2:185162559-185162581 GATGAAGAGATGTTGGTCAAGGG - Intergenic
943572453 2:189589819-189589841 GATGAAGAGAAGTTGGTTAAAGG - Intergenic
945655152 2:212614020-212614042 AATGAAGAGATATTGGTCAAGGG + Intergenic
945659430 2:212667342-212667364 GATGTAGGGGTATTGGTTTATGG + Intergenic
945686990 2:212983553-212983575 GATGAAGAGAGGTTGGTTAATGG + Intergenic
945712766 2:213320525-213320547 GATGAAGAGAAATTGGTTAATGG - Intronic
946015024 2:216597103-216597125 GGTAAAGAGCTAATGGTTACTGG - Intergenic
946189806 2:218002261-218002283 GATGGAGAGGTCTTGGTAGCAGG + Intronic
947165986 2:227262802-227262824 GGTGAAGAGAGATTGGTTAATGG + Intronic
948515612 2:238501556-238501578 CATGAAGAGGGATTGCTGACGGG - Intergenic
1169790361 20:9403636-9403658 GAAGCAGCTGTATTGGTTACAGG + Intronic
1170093585 20:12620086-12620108 GATGAAGGGAGATTGGTTAATGG + Intergenic
1170240233 20:14157521-14157543 GATGAAGAGAGGTTGGTTAATGG - Intronic
1170335005 20:15260255-15260277 GATAAAGAGGGAATGGTTAATGG - Intronic
1170801937 20:19597695-19597717 GATGAAGAGAGGTTGGTTAATGG - Intronic
1171247556 20:23624549-23624571 GATGAAGAGAAGTGGGTTACAGG + Intergenic
1171508997 20:25664593-25664615 AATGAAAAGGCATTGGTTAATGG - Intergenic
1172060453 20:32183794-32183816 GATGAAGTTGGATTGGTGACTGG + Intergenic
1173680595 20:44877586-44877608 GATGAAGTGGGATTTGTTCCGGG + Intergenic
1173697134 20:45027736-45027758 GATGAAGAGAAGTTGGTTAAGGG - Intronic
1173785497 20:45790135-45790157 GAAGAAGAGGGATTGGCTGCTGG + Intronic
1176897492 21:14398805-14398827 GATGAAGAGAGGTTGGTTAATGG - Intergenic
1177090928 21:16767319-16767341 AATGAAGAGTTATTGTTTAGTGG + Intergenic
1177459314 21:21389557-21389579 AATGAAGAGAGATTGGTTAATGG - Intronic
1177697818 21:24596324-24596346 GGTGAGGAGATATTGGTTATAGG - Intergenic
1179354909 21:40650165-40650187 GATGAAGAGGTTTTTGTTTTGGG - Intronic
1179359486 21:40692580-40692602 GATGAAGAGAGATTAGTTACCGG - Intronic
1180629221 22:17215815-17215837 GATGAAGAGAAGTTGGTTATGGG + Intronic
1183130712 22:35832499-35832521 GATGGAGAGAGGTTGGTTACTGG + Intronic
949246275 3:1928375-1928397 GATGAATAGGGTTTGGTTAATGG + Intergenic
949274587 3:2263754-2263776 GATGAAGAGAAGTTGGTTAAAGG - Intronic
949347892 3:3094251-3094273 GAAGGAGAGGTATTGTTTAATGG - Intronic
951606166 3:24437396-24437418 GATGAAGAGAAGTTGGTTAATGG + Intronic
951642438 3:24851097-24851119 GATGAAGACATATTGGAGACAGG + Intergenic
951977758 3:28532275-28532297 GATGAAGAGTGATTGGTTAATGG + Intronic
952192353 3:31037244-31037266 GATGATGAGAAATTGGTTAATGG + Intergenic
952243207 3:31556021-31556043 GATGAAGAGAGATTGGTCAATGG - Intronic
952441133 3:33330366-33330388 GATGAAGAGAGATTGATTAATGG + Intronic
952593540 3:34987885-34987907 GATGAAGAGAGGTTGGTTAATGG + Intergenic
953121853 3:40052157-40052179 GATGAAGAGAAGTTGGTTAAAGG - Intronic
954493209 3:50927287-50927309 GATGAGGAGGGATTGGTTAGTGG + Intronic
954568080 3:51616249-51616271 GATGAAGAGAGATTGATTAATGG - Intronic
954842330 3:53522891-53522913 GATGAAGAGAGGTTGGTTAATGG - Intronic
956829938 3:73036262-73036284 AATGAATAGAAATTGGTTACTGG + Intronic
956834789 3:73087964-73087986 GATGAAGAGAGATTGACTACTGG - Intergenic
957398718 3:79680445-79680467 GAAGAAGTGGTATGAGTTACTGG + Intronic
957667950 3:83260726-83260748 AATGTAGAGTTATGGGTTACAGG + Intergenic
957748152 3:84372584-84372606 GAAGAACAGCTAATGGTTACTGG + Intergenic
958061855 3:88494071-88494093 AATGAAGAAGTTTTGGTCACAGG - Intergenic
958831138 3:99090962-99090984 GATGAAGAGGAGTTGGATAAGGG + Intergenic
958961626 3:100515857-100515879 GATGAAGAGAGGTTGGTTAATGG + Intronic
959395608 3:105834111-105834133 GATGAAGAGCTATTGGTCAAAGG + Intronic
959595823 3:108127449-108127471 GAGGCAGAGGTATTGTTTCCTGG + Intergenic
959760020 3:109950663-109950685 GATAAAGAGGGGTTGGTTAATGG + Intergenic
959913505 3:111791946-111791968 GATGAAGAGGTTATGGTTAATGG - Intronic
960156945 3:114305905-114305927 GATGAGGAGGGATTTGTTAGGGG + Intronic
960221310 3:115112428-115112450 GATGAAGAGAGGTTGGTTAATGG - Intronic
960930913 3:122848938-122848960 GATGAAGAGAAGTTGGTTAAGGG - Intronic
960990757 3:123309679-123309701 GATGGAGAGGTCTTCGTTCCAGG - Intronic
961073213 3:123956920-123956942 GATGGAAAGGTATTGTTTAATGG - Intronic
961205012 3:125075016-125075038 GAAGAAGAGGCCTGGGTTACAGG + Intergenic
961221517 3:125204591-125204613 GATGAAGAGAGGTTGGTTAATGG + Intronic
961243849 3:125434931-125434953 GAGGAAGAGGTATGGGTCAGGGG - Intergenic
962650538 3:137484506-137484528 GATGAAGAGAGGTTGGTTAATGG - Intergenic
962743314 3:138379149-138379171 GATGAAGAGAAGTTGGTTAATGG - Intronic
963615374 3:147530065-147530087 GATGAAGAGAGGTTGGTTAATGG + Intergenic
963758939 3:149265818-149265840 GATGAAGAGAGGTTGGTTAATGG + Intergenic
963853495 3:150230504-150230526 GATGAAGAGAGGTTGGTTAATGG + Intergenic
963952618 3:151219860-151219882 CATGAAGTGGTTTTGGTTATTGG + Intronic
965255474 3:166402891-166402913 GATGAAGAGGTATTGGTTAATGG - Intergenic
965631525 3:170738221-170738243 GATGAAGAGAGGTTGGTTAATGG + Intronic
966106350 3:176340223-176340245 AATGAAGAGTGATTGGTTAATGG - Intergenic
966284845 3:178283043-178283065 AATGGAGAGTTATTGTTTACTGG + Intergenic
967115038 3:186329474-186329496 GATGAGGAGGTGTTTGTTCCTGG - Intronic
967227655 3:187307263-187307285 GATGCACAGGTACTGGTTAAAGG - Intergenic
967487281 3:190047795-190047817 AATGAAGAGGCATTGGTTAATGG + Intronic
967982233 3:195072584-195072606 GATGAAGAGGTATTTGATGATGG + Intronic
968280045 3:197469642-197469664 GATGAAGAGATGTTGGTTAATGG + Intergenic
969728068 4:8937279-8937301 GATGAAGAGAAGTTGGTTAAGGG + Intergenic
969840405 4:9877585-9877607 AATGAATAAGTATTGCTTACTGG - Intronic
970771858 4:19622657-19622679 GATAAAGAGATATTGGTTAATGG + Intergenic
971043605 4:22780993-22781015 GAAAAAGAGGTTTTGCTTACTGG - Intergenic
971855809 4:32042150-32042172 GATGAAGAAGTGTTAGTTAATGG - Intergenic
971876646 4:32317240-32317262 GGTGGAGAGGAATGGGTTACAGG - Intergenic
972354485 4:38267570-38267592 CAAGAAGAAGGATTGGTTACTGG + Intergenic
973079599 4:45972961-45972983 GAGGAAGAGGGAATGGTTTCCGG + Intergenic
973176907 4:47217958-47217980 GATGAAGAAAGATTGGTTAATGG - Intronic
973185129 4:47317887-47317909 GACCAAGAGGGATTTGTTACTGG - Intronic
973605664 4:52584887-52584909 AATGAGGAGGTATTAGTTAAAGG + Intergenic
974192353 4:58522414-58522436 GCTGAAGAGAAAATGGTTACTGG + Intergenic
974620813 4:64351159-64351181 CATGAAGAGAGATTGGTTAATGG + Intronic
975457738 4:74612396-74612418 GATGAAGAGAGGTTGGTTAATGG + Intergenic
975656590 4:76647284-76647306 GATGAAGAGATGTTGGTTAATGG + Intronic
976193721 4:82513393-82513415 AATGAGGAGGTATTGTTTAATGG + Intronic
976498087 4:85754040-85754062 GATGAAGAGAAATTGGTTAAGGG - Intronic
976564055 4:86533257-86533279 AATGAAGAGTTATTGTTTAATGG + Intronic
976952114 4:90846696-90846718 GATGAAGACGGGTTGGTTAATGG - Intronic
977973462 4:103237465-103237487 CATAAAGAGGTAGTGGTTATGGG + Intergenic
978142479 4:105333347-105333369 GATGAAGAGAAGTTGGTTAATGG + Intergenic
978824547 4:113005604-113005626 GATGAAGAGAGATTGGTTATGGG + Intronic
978994053 4:115128078-115128100 GATGATGAGGTATTACTTAGTGG - Intergenic
979020189 4:115487815-115487837 AATTAAGAGGTATTTGTTAAAGG - Intergenic
979174769 4:117650113-117650135 GATGAATAGTTAATGGATACTGG + Intergenic
980517697 4:133886006-133886028 GATAGAGAGGTGTTGGTTAATGG + Intergenic
980693312 4:136323726-136323748 GATAAAGAGAAATTGGTTAATGG + Intergenic
981253529 4:142632456-142632478 GATGAAGAGAGATTGATTAATGG + Intronic
981766704 4:148258866-148258888 GATTATGAGCTCTTGGTTACAGG - Intronic
981775976 4:148368175-148368197 GAGGAAGAGGTAGAGGTGACTGG - Intronic
981895283 4:149791549-149791571 GATAAAGAGGGAATGGTTAGTGG - Intergenic
981896420 4:149806452-149806474 GATGAAGGGAGATTGGTTAATGG - Intergenic
982040986 4:151396273-151396295 GATGAAGAGAGATTAGTTAATGG + Intergenic
982543090 4:156699295-156699317 GATGAAGAGAAGTTGGTTAAGGG + Intergenic
983299848 4:165911161-165911183 GATGAATAGAGATTGGTTAATGG - Intronic
984783581 4:183548080-183548102 GATGGAGAGATGTTGGTGACAGG - Intergenic
984897153 4:184551465-184551487 AATGAAGAGCTATTGTTTAATGG - Intergenic
985944759 5:3170512-3170534 GATGAAGAAGAATTGATTAATGG - Intergenic
986411318 5:7483031-7483053 GATGAAGAGACATTGGTTAATGG + Intronic
986639351 5:9857162-9857184 GATGAAGAGAAGTTGGTTAAGGG + Intergenic
986685765 5:10274139-10274161 GCTGAAGGGGAATTGGTGACGGG - Intergenic
986960747 5:13208600-13208622 GATAAAGAGGGGTTGGTTAATGG + Intergenic
987156569 5:15095579-15095601 GATGAGGAGTTATTGTTTAATGG - Intergenic
987544434 5:19294626-19294648 GATGAAGAGAGATTGGTTAATGG - Intergenic
987652830 5:20766272-20766294 GATGAAGAGAAGTTGGTTAAAGG + Intergenic
987921623 5:24290156-24290178 GATGGAGAGGAGTTGGTTAATGG + Intergenic
988742728 5:34095212-34095234 GATGAAGAGAAGTTGGTTAAAGG - Intronic
989248890 5:39284573-39284595 GATAAAGAGGAGTTGGTTAATGG - Exonic
989316396 5:40084439-40084461 AATGATGAGTTATTGATTACTGG + Intergenic
990157203 5:52890847-52890869 GATGAAGAGGGGTTAGTTAATGG - Intronic
990289767 5:54337683-54337705 GATTAAGAGGGATTTATTACAGG + Intergenic
991519350 5:67478424-67478446 GATGATGAGAAATTGGTTAATGG - Intergenic
992257923 5:74940598-74940620 GATGATGAGGAATTAGTTAATGG + Intergenic
992525110 5:77602084-77602106 GATGAAGAGAGGTTGGTTAATGG - Intronic
992734018 5:79700922-79700944 GATGAAGAGAGATTGATTAATGG + Intronic
993345855 5:86781276-86781298 GATGAAGAGAACTTGGTTAATGG + Intergenic
993362532 5:86996024-86996046 GATGAAGAGAGGTTGGTTAATGG - Intergenic
994000113 5:94769243-94769265 GGTGAAGAGAGATTGGTTAATGG + Intronic
994455844 5:100006695-100006717 GATGAAGAGAAATTGGTTAATGG - Intergenic
995839247 5:116427966-116427988 GATGAGTAGGAATTGGCTACAGG - Intergenic
995986974 5:118188592-118188614 GATGAAGACAGATTGGTTAATGG + Intergenic
996368786 5:122731250-122731272 GATGAAGAGAGGTTGGTTAACGG - Intergenic
996411860 5:123167280-123167302 GATGAAGAGAGATTGATTAATGG - Intronic
997347862 5:133205541-133205563 GAAGAATTGGTTTTGGTTACAGG - Intronic
997577675 5:134995261-134995283 GATGAAGAGAGGTTGGTTAATGG - Intronic
1000032516 5:157416489-157416511 GATGAAGAGAGGTTGGTTAATGG + Intronic
1000423316 5:161062083-161062105 GATGAGGAGTTATTTGTTAGGGG + Intergenic
1000572431 5:162931632-162931654 GATGAAGAGAGGTTGGTTAATGG - Intergenic
1001092914 5:168754498-168754520 GATGAAGAGAGGTTGGTTAATGG + Intronic
1003326412 6:5094850-5094872 GATGAAGAGGAGTTGGTTAATGG + Intergenic
1004815898 6:19311407-19311429 GATGAAGAGAGGTTGGTTAATGG + Intergenic
1004979725 6:21009857-21009879 GATGAAGAGAGATTGGTTAAGGG + Intronic
1006191024 6:32209368-32209390 GATGAAGAGAGGTTGGTTAATGG + Intronic
1007553790 6:42749398-42749420 GATGAAGTGAGATTGGTTAAAGG + Intronic
1008330962 6:50243860-50243882 GAGGAAGAGGTATTTGATATTGG + Intergenic
1008394233 6:50988577-50988599 GATGAAGAGAAGTTGGTTAATGG + Intergenic
1009636463 6:66271280-66271302 GATGAAGAGAAGTTGGTTAATGG + Intergenic
1010130077 6:72481651-72481673 TATGAAGAGAAACTGGTTACTGG + Intergenic
1010246605 6:73665375-73665397 GATGAAGAGAAGTTGGTTAATGG + Intergenic
1010475154 6:76277514-76277536 GATGAAGAGAGGTTGGTTAATGG - Intergenic
1010566502 6:77420822-77420844 GATGGAGAGATATTGGTCAAAGG + Intergenic
1010731472 6:79395901-79395923 GATGAAGAGGCAGTGGCTACAGG - Intergenic
1010763192 6:79748179-79748201 GTTGAAGAGCTAGTGTTTACTGG + Intergenic
1011067491 6:83343132-83343154 GATGAAGAGAGGTTGGTTAAGGG - Intronic
1011127830 6:84025679-84025701 GATAAAGAGGAGTTGGTTAATGG + Intergenic
1011140301 6:84147347-84147369 GATGAAGAGAGGTTGGTTATGGG + Intronic
1012012996 6:93815268-93815290 GATGAAGAGAAATTAATTACTGG + Intergenic
1012562757 6:100604985-100605007 GAGAAAGGGGTAGTGGTTACTGG + Intronic
1012746578 6:103098248-103098270 GATGAAGAGAATTTGGTTACTGG - Intergenic
1012935917 6:105366952-105366974 AATGAAGAGTTATTGTTCACAGG + Intronic
1012986281 6:105879468-105879490 GATGAAGAGGGGTTGGCAACAGG + Intergenic
1013214317 6:108013633-108013655 GATGAAGAGAGGTTGGTTAATGG + Intergenic
1014549721 6:122776535-122776557 GATGAAGAGGGAATGGTTAATGG + Intergenic
1015017588 6:128433235-128433257 GATGAAGAGGGGTTGGTTGATGG - Intronic
1015027551 6:128555238-128555260 GATGAGGTTGTATTGATTACAGG + Intergenic
1017181461 6:151556853-151556875 GATGAAGAGAGATTGGTTAATGG - Intronic
1017897737 6:158695673-158695695 GATGGAGAGTTATTGTTTAATGG - Intronic
1020562832 7:9752410-9752432 GATGAAGAGCTATTGGTTAATGG - Intergenic
1021743873 7:23717940-23717962 GATGAGGAGTTATTGATTAATGG + Intronic
1022293749 7:29029669-29029691 GACGAAGAGAGATTGGTTAAGGG + Intronic
1022610925 7:31872247-31872269 GATAAAGAGGGATTGGTTAATGG + Intronic
1022995599 7:35752148-35752170 GATGAAGAGAGATTGATTAATGG - Intergenic
1025918931 7:65891929-65891951 AATAAAGAGGGATTGGTGACTGG - Intronic
1027898943 7:84083577-84083599 TATGAAGAGGGAATGGTTAATGG - Intronic
1029019960 7:97354398-97354420 AATGATGAGGTTTTGGTTTCCGG + Intergenic
1030176297 7:106659304-106659326 GAAGAACTGGTTTTGGTTACAGG - Exonic
1030682201 7:112445703-112445725 GCTGAAGAGAGATTGGTGACTGG + Intronic
1031217520 7:118914658-118914680 GATGAAGAGAGACTGGTTAACGG + Intergenic
1031313781 7:120231880-120231902 TATGAAGAATTATTGGATACAGG + Intergenic
1031565115 7:123286777-123286799 GATGAAGAGGGGTTTGTTAATGG - Intergenic
1031656579 7:124363382-124363404 AATGAAGAGGAGTTGGTTAATGG + Intergenic
1031703488 7:124955342-124955364 GATTAAGAGATGTTGATTACAGG + Intergenic
1031733200 7:125323248-125323270 GATGAGGAGGGATTGGTTAACGG - Intergenic
1032353003 7:131183399-131183421 GATCAAGAGGGAATGATTACAGG - Intronic
1032900188 7:136298377-136298399 GATGAAGAGAAGTTGGTTAATGG + Intergenic
1033447320 7:141434748-141434770 GATGAAGAAAGATTGGTTAATGG - Intronic
1034917667 7:155054306-155054328 GAAGAAGAGCTAATGGATACTGG - Intergenic
1035489416 7:159259853-159259875 GTTGAAGAGGTCTCTGTTACTGG + Intergenic
1035944233 8:3942287-3942309 GAAGAGGAGGGATTGGTTTCAGG - Intronic
1036116343 8:5964407-5964429 GATGAAGAGAAGTTGGTTAATGG - Intergenic
1037101143 8:15048345-15048367 GATGAAGAGAGGTTGGTTAATGG + Intronic
1037697613 8:21239517-21239539 AATGTAGAGGTATTGGCTAATGG - Intergenic
1038065457 8:23959140-23959162 GATGAAGAGAGGTTGGTTAATGG - Intergenic
1038136123 8:24787708-24787730 GATGAAAAGGTTTTGGTTTTGGG - Intergenic
1038250645 8:25900843-25900865 GATGAAGAGAGGTTGGTTAATGG + Intronic
1041034871 8:53778458-53778480 GATGAAGTGAGATTGGTTAATGG - Intronic
1041262423 8:56033320-56033342 GATGAAGGGGAGTTGGTTAAAGG + Intergenic
1041368902 8:57139375-57139397 GATGAAGAGAAGTTGGTTAAGGG - Intergenic
1041415254 8:57600812-57600834 GATGAAGAGTGGTTGGTTAATGG + Intergenic
1042903776 8:73752878-73752900 AATGAAGAGGGATTGGTTAATGG + Intronic
1043534413 8:81186236-81186258 GATGAAGAGAGATTGGTTAATGG + Intergenic
1043551745 8:81381228-81381250 GATGAAGAGCAATAGGTTAAAGG - Intergenic
1045376555 8:101580428-101580450 GATGAAGAGAGGTTGGTTAATGG - Intronic
1045532441 8:102997713-102997735 GATGAAGAGAAATTGGTTAAGGG - Intergenic
1045543690 8:103109558-103109580 GATGAAGAAGGATTGGTGAATGG + Intergenic
1045622671 8:104000175-104000197 GATGAAGAGGGGTTGGTTAATGG - Intronic
1045633645 8:104157533-104157555 AATGAAGAGTTATTGCTTAATGG - Intronic
1046120857 8:109844974-109844996 GATGAAGAGAGGTTGGTTAATGG - Intergenic
1046209409 8:111048034-111048056 GATGAAGAGAGCTTGGTTAATGG + Intergenic
1046306806 8:112378669-112378691 GATGAAGAGAGGTTGGTTAATGG + Intronic
1046383808 8:113483771-113483793 GAGGAAGTGGTAATGGTTAATGG - Intergenic
1046825177 8:118682090-118682112 TATGCAGAGGGATTGGTTCCAGG - Intergenic
1047433511 8:124814776-124814798 GCTGAAGAGGTGTCAGTTACAGG + Intergenic
1047521647 8:125599541-125599563 GATGCAGATGTATTTGATACAGG - Intergenic
1048006020 8:130419843-130419865 GAGGAAGAGTTATTGGAAACCGG - Intronic
1048011602 8:130461512-130461534 GATGAAGAGAGTTTGGTTAATGG + Intergenic
1048621943 8:136143351-136143373 GATGAGTAGGTATTTCTTACTGG + Intergenic
1050162264 9:2731069-2731091 AATGAAGAGGAAAAGGTTACAGG - Intronic
1050218448 9:3357609-3357631 GATGAAGAGAAGTTGGTTAATGG + Intronic
1050380472 9:5023131-5023153 AATGAAGAGATGTTGGTTAATGG - Intronic
1050489700 9:6175306-6175328 GATGAAGAGAAGTTGGTTAAAGG + Intergenic
1050754804 9:8989333-8989355 AATGAAGAGAAATTGGTTAAGGG - Intronic
1050877492 9:10656925-10656947 GATGAAGAGAGCTTGGTTAATGG + Intergenic
1050988957 9:12121877-12121899 GGTGAAGAGAGATTGGTTAATGG - Intergenic
1051073140 9:13197726-13197748 GATGAAGAGGTATTGGTTACTGG - Intronic
1051156481 9:14152886-14152908 GATGAAGAGAGATTGGTTAATGG + Intronic
1051332387 9:16036025-16036047 GAAGAAAAGTTATTGGTTTCAGG + Intronic
1052114378 9:24631785-24631807 AATGAAGAGATATTGGTTAAAGG - Intergenic
1052476256 9:28963795-28963817 GATGAATAGAGATTGGTTAATGG + Intergenic
1052658546 9:31398238-31398260 GATGAAGAGAAGTTGGTTAATGG - Intergenic
1052782900 9:32798888-32798910 GATAAAGAGTCATTGGTTAATGG + Intergenic
1053374735 9:37596004-37596026 GAAGAATTGGTGTTGGTTACAGG + Intronic
1053607715 9:39678430-39678452 GTTGAAGAGGTAGTGTTTATTGG - Intergenic
1053865563 9:42434797-42434819 GTTGAAGAGGTAGTGTTTATTGG - Intergenic
1054245820 9:62663979-62664001 GTTGAAGAGGTAGTGTTTATTGG + Intergenic
1054559945 9:66698510-66698532 GTTGAAGAGGTAGTGTTTATTGG + Intergenic
1054915015 9:70487456-70487478 GATGAAGAGAGGTTGGTTAATGG + Intergenic
1056181847 9:84091901-84091923 GATGAAGAGATGTTGGTAAATGG - Intergenic
1056187402 9:84149104-84149126 GATGAAGAGAGGTTGGTTAATGG - Intergenic
1056441043 9:86621606-86621628 GATGAATATGAATTGGATACAGG + Intergenic
1057980424 9:99656026-99656048 GATGAAGAGAGGTTGGTTAATGG + Intergenic
1057992900 9:99790800-99790822 GATAAAGAGAAATTGGTTAAGGG - Intergenic
1058086978 9:100758413-100758435 GATAAGGAGAGATTGGTTACTGG - Intergenic
1058928653 9:109695884-109695906 GATGAAGAGAGGTTGGTTAAGGG + Intronic
1059954081 9:119497984-119498006 GATGAAGAAGTGTTGGTTAATGG - Intronic
1060708165 9:125827001-125827023 GATAAAGAGGGATTGGTTAATGG - Intronic
1061749533 9:132767966-132767988 GGTGAAGAGAGGTTGGTTACTGG + Intronic
1186003894 X:5046277-5046299 GATGGGGAGATATTGGTTAAAGG - Intergenic
1187894865 X:23971289-23971311 GATGAAGAGAGGTTGGTTATTGG - Intergenic
1187968129 X:24632796-24632818 GATGAAGAGAGGTTGGTTACTGG + Intronic
1188144616 X:26595657-26595679 GATGAGGAGGGGTTGGTTAATGG + Intergenic
1188391148 X:29621897-29621919 GATAAAGAGAGATTGGTTAATGG - Intronic
1188429976 X:30095660-30095682 GTTGAAGAGATATTGGTCAAAGG - Intergenic
1188628773 X:32324011-32324033 GGTGAAGAGAGATTGGTTACTGG + Intronic
1188747772 X:33867897-33867919 GATAAAGAGTGATTGGTTAGTGG + Intergenic
1188754993 X:33951630-33951652 GATGAAAAGAAATTGGTTAATGG + Intergenic
1189108281 X:38259279-38259301 GATGAAGAGAGGTTGGTTAATGG - Intronic
1189686503 X:43569490-43569512 GATGAAGAGAAATTGGTTAAAGG + Intergenic
1190482956 X:50895838-50895860 GATGAAGAGCAATTGGTTAATGG + Intergenic
1191686515 X:63898148-63898170 GATGAAGAGGGGTTGGTTGATGG + Intergenic
1191975980 X:66871952-66871974 GATAAAGAGATGTTGGTTAATGG - Intergenic
1192187749 X:68964280-68964302 GATAAAGAGGGATTGGTTAATGG - Intergenic
1192400632 X:70831313-70831335 GATGAGGAGATATTGGTCAAAGG + Intronic
1192938826 X:75891646-75891668 AATGAAGAGATGTTGGTTAATGG + Intergenic
1193193801 X:78605841-78605863 GATGAAGAGAAGTTGGTTAACGG + Intergenic
1193482124 X:82039869-82039891 GATGAAAACATCTTGGTTACAGG + Intergenic
1193875515 X:86857801-86857823 AATTAAGAGATTTTGGTTACTGG - Intergenic
1194035177 X:88862478-88862500 GATGAAGAGAGATTAGTTAATGG - Intergenic
1194349015 X:92802662-92802684 GATAAAGAGAAATTGGTTAATGG + Intergenic
1194795248 X:98203112-98203134 GATGAAGAGGAAGAGGTTAATGG + Intergenic
1195344305 X:103934112-103934134 AATGAAGAGAGATTGGTTAATGG - Intronic
1195362649 X:104099133-104099155 AATGAAGAGAGATTGGTTAATGG + Intergenic
1195596083 X:106691496-106691518 GATGAAGAGAAGTTGGTTAATGG - Intergenic
1196008544 X:110861611-110861633 GATGAAGAGAAGTTGGTTAGGGG + Intergenic
1196089576 X:111725483-111725505 GATAAAGAGGGATTAGTTAATGG + Intronic
1196134504 X:112193407-112193429 GATAAATAGGGATTGGTTAATGG - Intergenic
1196240045 X:113332835-113332857 GATGAAGAGAAGTTGGTTAATGG - Intergenic
1196560127 X:117136462-117136484 GATGAAGAGAGGTTGGTTAGTGG - Intergenic
1196575229 X:117309319-117309341 GATGAAGAGAGGTTGGTTAAGGG + Intergenic
1196851864 X:119945635-119945657 GATGAAGAGAAATAGGTTAAAGG - Intergenic
1196883192 X:120219024-120219046 GATGAAGAGAAGTTGGTTAATGG + Intergenic
1196921391 X:120589146-120589168 GATGAAGAAAGATTGGTTAATGG + Intergenic
1196931989 X:120690986-120691008 AATGAGGAGTTATTGCTTACTGG - Intergenic
1196941306 X:120778720-120778742 GATGAATAGGTAATGGATGCTGG + Intergenic
1197597955 X:128489852-128489874 GATGAACAGGTTTTTGTCACAGG + Intergenic
1197625220 X:128794461-128794483 GATCATGCGGTATTGGTCACTGG - Intergenic
1197798242 X:130320582-130320604 GATGAAGAGAGGTTGGTTAATGG - Intergenic
1198171549 X:134110793-134110815 GATGAAGAGAGGTTGGTTAATGG - Intergenic
1198798888 X:140429586-140429608 GATGAAGTGGGAATGGTTAATGG + Intergenic
1198813329 X:140559201-140559223 GATGAAGAGAAGTTGGTTAATGG - Intergenic
1199192315 X:144984410-144984432 GATGAAAAGAGGTTGGTTACTGG + Intergenic
1199274999 X:145930560-145930582 GAAGAAGAGAAGTTGGTTACTGG - Intergenic
1199783881 X:151086682-151086704 GATGGAGAGTTATTGCTTAAAGG - Intergenic
1199842977 X:151669517-151669539 GATGAAGAGAAGTTGATTACTGG - Intronic
1200717414 Y:6564608-6564630 GATGAAGAGAGATTAGCTACGGG + Intergenic