ID: 1051073141

View in Genome Browser
Species Human (GRCh38)
Location 9:13197733-13197755
Sequence GGGGTGGGATGAAGAGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 793
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 742}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051073141_1051073149 2 Left 1051073141 9:13197733-13197755 CCAATACCTCTTCATCCCACCCC 0: 1
1: 0
2: 4
3: 46
4: 742
Right 1051073149 9:13197758-13197780 CTCAAACTCTTCCAAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051073141 Original CRISPR GGGGTGGGATGAAGAGGTAT TGG (reversed) Intronic
900956630 1:5890004-5890026 GGGGTGGGGGGATGGGGTATGGG - Intronic
902051479 1:13567018-13567040 GGGGTGGTATGGAGAGATAATGG - Intergenic
902996592 1:20230322-20230344 GAGGTGGGATGAAATGGGATGGG - Intergenic
903725307 1:25438205-25438227 GGGGAGGGGTGAAGAAGCATAGG + Intronic
904394371 1:30208634-30208656 GGGGTGGTATGGAGAGATAATGG - Intergenic
904712042 1:32437542-32437564 GGGGTGGTATGGAGAGATAATGG - Intergenic
904920783 1:34006398-34006420 GGGGTGGGATGGGGTGGAATAGG - Intronic
904985416 1:34543909-34543931 GGGGTGGGAAGAGGGGATATGGG + Intergenic
905119795 1:35672846-35672868 GAGGTGGGATGATGAGATGTGGG - Intergenic
905333420 1:37225605-37225627 GAGGTGAGATGAAGAAGAATGGG + Intergenic
905500190 1:38430273-38430295 GGGGTGGTATGGAGAGATAATGG - Intergenic
905652558 1:39666229-39666251 GGCTTGGGCTGCAGAGGTATGGG + Exonic
905678045 1:39843748-39843770 GGGGTGGGATCAGGAAGTAAGGG - Intronic
905850793 1:41273187-41273209 GGGGTGGCCTGAGGAGGTTTGGG - Intergenic
906744103 1:48209486-48209508 GGGGTGGTATGGAGAGATAATGG + Intergenic
907272891 1:53301027-53301049 GGGGTGGGGTGGAGTGGTGTGGG + Intronic
907504467 1:54907722-54907744 GGGGTGGCATGGAGAGATAATGG + Intergenic
908570081 1:65400461-65400483 GGGCAGGGATGAGGAGGCATTGG - Intronic
909347675 1:74611213-74611235 GGGGTGGAATGAAGTGGTTTTGG - Intronic
909931591 1:81504268-81504290 GGGGAGGGCTGAAGAGGGCTGGG - Intronic
911071667 1:93836585-93836607 GGGGTGGTATGGAGAGATAATGG - Intronic
911082435 1:93946775-93946797 GGGGTGGAATGAAGAGAGGTTGG - Intergenic
911088976 1:94002346-94002368 CGGGTGGGATCAACAGGTCTGGG - Intronic
911510175 1:98801572-98801594 GGGGTGGTATGGAGAGATAATGG + Intergenic
911759243 1:101597701-101597723 GGGGTGGTATGGAGAGATAATGG + Intergenic
911967698 1:104388110-104388132 GGGGTGGTATGGAGAGATAATGG - Intergenic
911983652 1:104596838-104596860 GGGGTGGTATGGAGAGATAATGG - Intergenic
911984399 1:104602293-104602315 GGGGTGGTATGGAGAGATAATGG - Intergenic
912191569 1:107346985-107347007 GGGGTGGAAGGAAGAGGAAGAGG + Intronic
912639015 1:111326279-111326301 GGTGGGGGATGAAGAGAGATAGG - Intergenic
912718788 1:112002591-112002613 GGGGTGGGAAGAAGAATGATGGG - Intergenic
912870068 1:113295547-113295569 GGGTTGGGGTGAAGAGACATTGG + Intergenic
913302352 1:117385599-117385621 GGGGTGGGGTGATGAGTTAAAGG + Intronic
913329901 1:117658698-117658720 GGTGTGGGATGCAGAGGGAGGGG + Intergenic
913720838 1:121592721-121592743 GGGGAGGGAAGAAGAGTAATTGG + Intergenic
914375655 1:147071638-147071660 GAGGTTGGATGCAGAGGTGTTGG + Intergenic
914754443 1:150554657-150554679 GGGGTGGGAGGAGGAGGTGTGGG + Intronic
915546074 1:156598720-156598742 GGGGAGGGAAAAAGAGATATGGG - Intronic
916271969 1:162952841-162952863 GGAGTGGGAAGATGAGGTAGGGG - Intergenic
916329265 1:163596035-163596057 GGGGTGGTATGAAGAGATAATGG - Intergenic
916540875 1:165752862-165752884 CGGGTGGCAAGAAGAGGAATTGG - Intronic
917220580 1:172724413-172724435 GGGGTGGGGTTAAGATGAATAGG + Intergenic
917239920 1:172937026-172937048 GGGAAGGGCTGAAGAGATATTGG + Intergenic
917750129 1:178045370-178045392 GGGGTGGTATGGAGAGATAATGG - Intergenic
917880012 1:179325746-179325768 GGGGTGGAAAGTAGAGGTTTTGG + Intronic
917950310 1:180025963-180025985 GGGGTGGAAGGAACAGGAATAGG + Intronic
918196304 1:182225564-182225586 GAGGAGGGATAAAGAGGGATTGG - Intergenic
918365793 1:183806386-183806408 GGACTGGGGTGAAGAGGTAGAGG + Exonic
918645727 1:186902483-186902505 GGGGTGGTATGGAGAGATAATGG - Intronic
918652560 1:186983763-186983785 GGGGTGGGATGCAGAGGCATTGG + Intronic
919476878 1:198040488-198040510 GGGGTGGTATGGAGAGATAATGG - Intergenic
920131079 1:203732293-203732315 GGAGGGGGAGGAAGAGGTTTTGG - Intronic
920199759 1:204252334-204252356 GGGATGGGATGAGGAGGAAGAGG + Intronic
920338452 1:205260190-205260212 GGGGTGGGGTGAGGAGGTCATGG + Intronic
920649142 1:207823767-207823789 GGGGTGGGAGCAAGAGGTTGTGG - Intergenic
920901126 1:210111518-210111540 GGGGTGGTATGGAGAGATAATGG + Intronic
920908832 1:210195203-210195225 GGGGTGGTATGGAGAGATAATGG - Intergenic
921205637 1:212846285-212846307 GGGGTGGTATGGAGAGATAATGG - Intronic
921225498 1:213015490-213015512 GGGGTGGAAGGAAGAGGAAGAGG - Intronic
921582311 1:216909297-216909319 GGGGAGGGCTGTAGAGGTCTTGG - Intronic
922089252 1:222379918-222379940 GGGGTTGGAGAAAGAGATATTGG - Intergenic
922137293 1:222841921-222841943 GAGGTGGGATCCAGAGGGATTGG + Intergenic
922254548 1:223882199-223882221 GAGGAGGGATGAATAGGTAGGGG + Intergenic
922599351 1:226837874-226837896 GGGGTGGCATGGAGAGATAATGG - Intergenic
922844907 1:228677065-228677087 GGGGTGGTATGGAGAGATAATGG + Intergenic
922869119 1:228885874-228885896 GGAGTGCGATGACGTGGTATCGG - Intergenic
922895479 1:229096890-229096912 GGGGAGGGAAGAAAAGGGATGGG + Intergenic
923408216 1:233683955-233683977 GGGGTGGTATGGAGAGATAATGG + Intergenic
924089932 1:240491862-240491884 GGCTTGGGATGGATAGGTATAGG - Exonic
924695067 1:246390427-246390449 GGGGAGGGATGAAGCTGTATGGG + Intronic
924895700 1:248336191-248336213 GGGGTGGTATGGAGAGATAATGG + Intergenic
1062885229 10:1011092-1011114 GGGGTGGGGGGAAGAGGTGCAGG - Intronic
1062931232 10:1354125-1354147 GGGGTGGTATGGAGAGATAATGG - Intronic
1063848577 10:10160173-10160195 GGGAGGGGAAGAAGAGGAATTGG + Intergenic
1064243940 10:13654706-13654728 TGGGTGGGATGCAGAGGTTGGGG - Intronic
1064416273 10:15152968-15152990 GGGATGGATTGAAGAGGTAATGG + Intronic
1065610969 10:27470391-27470413 GGGGTGGTATGGAGAGATAATGG - Intergenic
1066436645 10:35402087-35402109 GGGGTGGTATGGAGAGATAATGG + Intronic
1067283768 10:44892616-44892638 GAGGAGAGATGAAGAGGGATCGG - Intergenic
1067920196 10:50447907-50447929 AGGGTGTGAGGAAGTGGTATAGG - Intronic
1068522668 10:58094556-58094578 GGGGTGGTATGGAGAGATAATGG + Intergenic
1069212072 10:65774148-65774170 AGGGTGGGATGAAAAGATGTAGG - Intergenic
1070092967 10:73307078-73307100 CGGGAGGGATGGAGATGTATAGG + Intronic
1070640507 10:78165473-78165495 GGGATGGTGAGAAGAGGTATTGG - Intergenic
1070815253 10:79318674-79318696 GAGGCGGGAGGCAGAGGTATGGG - Intergenic
1071774601 10:88771388-88771410 GGGGAAGGATAAAGAGGCATTGG - Intronic
1071822237 10:89290407-89290429 GGGGTGGCATGGAGAGATAATGG - Intronic
1072251261 10:93584046-93584068 TGGGTGGGCTGCAGAGGAATTGG - Intronic
1072528004 10:96291364-96291386 GGAGTGGGATGGTGAGGGATGGG - Intergenic
1072661282 10:97365032-97365054 GGGTTGGAATGAAGATGAATCGG - Intronic
1072677926 10:97482518-97482540 GGGTTGGGAAGAAGAGGGAAGGG + Intronic
1072689564 10:97562922-97562944 GGGGTGGTATGGAGAGATAATGG + Intronic
1072884966 10:99264908-99264930 GGGGTGGTATGGAGAGATAACGG - Intergenic
1073014617 10:100387948-100387970 GGGGTGGTATGGAGAGATAATGG - Intergenic
1073130314 10:101184347-101184369 GGGGTGGTATGGAGAGATAATGG + Intergenic
1073436608 10:103520715-103520737 GGGGTGGTATGGAGAGATAATGG + Intronic
1073453418 10:103622632-103622654 GGGGTGGGAGGAAGGGGCACAGG + Intronic
1074019490 10:109567742-109567764 GGGGTGGTATGGAGAGATAATGG - Intergenic
1074251189 10:111749905-111749927 GGGGTAGGAAGATGAGGAATGGG + Intergenic
1075014423 10:118899821-118899843 GGGGTGGTATGGAGAGATAATGG - Intergenic
1075492474 10:122884277-122884299 GGGGAGGGATGAAGAAGATTAGG + Intergenic
1075542977 10:123330793-123330815 TAGGTGGGATGATGAGGGATAGG + Intergenic
1075548958 10:123378179-123378201 GGGGTGGGAGGGAGAGGGGTCGG - Intergenic
1075971416 10:126657310-126657332 GGGCTGGGAGGAGGAGGAATGGG - Intronic
1076111498 10:127863138-127863160 GGGGTGGGAGGAAGAGGCAGCGG - Intergenic
1076294194 10:129371817-129371839 GGGGCTGGATGCAGAGGAATGGG - Intergenic
1076312180 10:129516420-129516442 GGGGTGGGGTGAAGGGATACAGG + Intronic
1076549635 10:131270059-131270081 GTGTTGGGAAGAAGAGGTGTGGG + Intronic
1076655643 10:132021808-132021830 GGGGTGGGTGGAAGAGGTGTTGG + Intergenic
1077021334 11:418408-418430 GGGGTGGGATGGGCAGGCATTGG + Exonic
1077096336 11:800694-800716 GGGGTGGGGTGCAGAGCTTTGGG - Intronic
1077437617 11:2550370-2550392 GGGGTTGAATGAAAAGGCATAGG + Intronic
1077532678 11:3104555-3104577 GGGGTGGGGTGGAGACGCATTGG - Intronic
1077650312 11:3965597-3965619 GGAGTGGGATGAAGGGGTAGTGG - Intronic
1078551957 11:12287368-12287390 GGGGTGGGGTGGAGGGGGATGGG - Intronic
1078736537 11:14025612-14025634 GGGGTGGGGTGAAGAAGTGCTGG + Intronic
1078789541 11:14528533-14528555 GGGGTGGTATGGAGAGATAATGG - Intronic
1079231027 11:18648948-18648970 GGGGTGGTATGGAGAGATAATGG - Intergenic
1079835396 11:25327362-25327384 GGGGTGGCATGGAGAGATAATGG + Intergenic
1079847154 11:25486979-25487001 GGGGTGGTATGGAGAGATAATGG + Intergenic
1080685213 11:34509629-34509651 GGGGTAGGATGCTGAGGGATGGG + Intronic
1080993998 11:37578813-37578835 GGGGTGGTATGGAGAGATAATGG + Intergenic
1081160253 11:39740536-39740558 GGGGTGGTATGGAGAGATAATGG - Intergenic
1081762341 11:45585088-45585110 GTTGTGGGATGAAGAGCCATTGG - Intergenic
1081874241 11:46397723-46397745 GGGCTGGGGTGAGGAGGTGTGGG + Exonic
1082197214 11:49321023-49321045 GGGGTGGTATGGAGAGATAATGG + Intergenic
1083534944 11:63458961-63458983 GGGGTGGTATGGAGAGATAATGG - Intergenic
1083537943 11:63489317-63489339 GGGCTGGGATGAAAAGGGAAAGG - Intronic
1083943643 11:65912010-65912032 GGGGAGGGAGGAAGAGGAACTGG + Intergenic
1084008638 11:66335918-66335940 GGGGTGGGAGGGAGAGGGATGGG - Intronic
1084243893 11:67842377-67842399 GGGGTGGTATGGAGAGATAATGG + Intergenic
1084828795 11:71752204-71752226 GGGGTGGTATGGAGAGATAATGG - Intergenic
1084887629 11:72221381-72221403 GGGGTGGGGTGAAGATTTCTGGG + Intronic
1084950981 11:72665357-72665379 GGGGTGGGATGGGGAGGACTGGG - Intronic
1085014111 11:73161296-73161318 GGGGTAGGAGGAAGGGGAATGGG - Intergenic
1085642586 11:78201869-78201891 TGGGTGGGGTGAAGGGGTCTAGG + Intronic
1086134278 11:83431119-83431141 GGGGTGGTATGGAGAGATAATGG + Intergenic
1086550741 11:88049133-88049155 GGGGTGGTATGGAGAGATAATGG - Intergenic
1087099503 11:94350919-94350941 GGGGTGGTATGGAGAGATAATGG - Intergenic
1089231200 11:116978362-116978384 GGAGTGGGATGAGGTGGTACTGG - Intronic
1089325268 11:117652575-117652597 AGGCTGGGAAGAAGAGGTAGAGG + Intronic
1090040364 11:123285343-123285365 GGCATGGGAGGAAGAGGGATCGG - Intergenic
1090107125 11:123865787-123865809 GGGGTGGTATGGAGAGATAACGG + Intergenic
1090924624 11:131238592-131238614 GGGGTGGGAAGGAGGGGTCTTGG + Intergenic
1090979607 11:131707148-131707170 GGGGTGGGGTGATGGGGTAAGGG - Intronic
1092103738 12:5905926-5905948 GGGGTGGGATGAAGGGATAGGGG - Intronic
1092211721 12:6650813-6650835 GAGGGGGAATGAAGAGGTCTGGG + Exonic
1092414451 12:8279496-8279518 GGGGTGGTATGGAGAGATAATGG + Intergenic
1092548192 12:9469690-9469712 GGGGTGGGAAGAAGGGGGTTAGG - Intergenic
1092738915 12:11610265-11610287 GGGGTGGTATGGAGAGATAATGG + Intergenic
1092790120 12:12063586-12063608 GGGGTGGTATGGAGAGATAATGG - Intronic
1092924369 12:13260103-13260125 GGGGTGGTATGGAGAGATAATGG + Intergenic
1093060854 12:14601811-14601833 AGGGGGGGGTGAAGAGGGATTGG - Intergenic
1093303048 12:17477967-17477989 GGGGTGGTATGGAGAGATAATGG - Intergenic
1093321563 12:17720724-17720746 GGGGTGGTATGGAGAGATAATGG + Intergenic
1093339557 12:17955282-17955304 GGGTTGGGATGAGGAAGTGTGGG + Intergenic
1093550057 12:20398974-20398996 GGGCTGGGAGGAAGAGGGAATGG - Intronic
1093812380 12:23506365-23506387 GGGGTGGCATGGAGAGATAATGG + Intergenic
1093951598 12:25169011-25169033 GGGGTGGTATGGAGAGATAATGG - Intronic
1094322291 12:29198802-29198824 GGGGTGCGATGAGGGGGCATAGG - Intronic
1094456043 12:30634170-30634192 TGACTGGGATGAAGAAGTATTGG - Exonic
1094504813 12:31052763-31052785 GGGGTGGGAAGAAGGGGGTTAGG + Intergenic
1094723397 12:33088355-33088377 GGGGTGGTATGGAGAGATAATGG + Intergenic
1095638121 12:44455560-44455582 GGGGTGGTATGGAGAGATAATGG - Intergenic
1095989040 12:48021483-48021505 GAGGTGGGATGAGGAGGTAGGGG + Intronic
1095989218 12:48022896-48022918 GGGGAGGGGTGAAGAGGTGTAGG - Intronic
1096476118 12:51910278-51910300 GGAGTGGGATGCAGAGGGAGGGG - Intronic
1096638741 12:52977590-52977612 CGGGTGGTATGAAGAGGGACTGG - Intergenic
1097007663 12:55931015-55931037 GGGGTGGGAAGAAGGGGGAGGGG - Exonic
1097645219 12:62228171-62228193 GGGGAGGGAGGAAGAGGGAAAGG - Intronic
1097650480 12:62292137-62292159 GGGGTGGGATGGGGGGGTGTGGG + Intronic
1098406461 12:70131761-70131783 GGGGTGGTATGGAGAGATAATGG + Intergenic
1098629568 12:72709195-72709217 GGGGTGGTATGGAGAGATAATGG + Intergenic
1098701397 12:73632340-73632362 GGGGTGGGGTGGAGAGGGATGGG + Intergenic
1098920407 12:76297276-76297298 GGGGTGGTATGGAGAGATAATGG - Intergenic
1099717668 12:86316711-86316733 GGGGAGGGATGAAGAAATAGGGG + Intronic
1100441116 12:94617774-94617796 GGGGTGGGATGGAGAGAAAAGGG + Intronic
1100661905 12:96708499-96708521 GGTGTTGGATGAAGGGATATAGG - Intronic
1100681328 12:96925639-96925661 CTGGTGTGAGGAAGAGGTATAGG - Intronic
1100940827 12:99721234-99721256 GGGGTGGTATGGAGAGATAACGG - Intronic
1101791101 12:107928550-107928572 GGGGTGGGAGGAAAAGACATAGG + Intergenic
1102116277 12:110405534-110405556 GGGGTGGTATGGAGAGATAATGG + Intergenic
1102394262 12:112574243-112574265 GGGGAGGGAGGAAGAGGAAGAGG + Intronic
1103244882 12:119448009-119448031 GGGGAGGGATGGAGTGGAATGGG + Intronic
1103248704 12:119481153-119481175 GGGATGGGATGGAGTGGGATAGG - Intronic
1106062528 13:26308773-26308795 GGAGTGGGCTGAAGAGGAAATGG - Intronic
1106485270 13:30166899-30166921 AGAGTGGGAGGAAGAGGTCTGGG - Intergenic
1107015693 13:35706434-35706456 GGGGTGGGAGGAAGAGCTAGAGG + Intergenic
1107119160 13:36778726-36778748 GGGGTGGGAGGTAGAGGGAAGGG - Intergenic
1107377535 13:39820725-39820747 GGGCTGGGATGCAGAGCTGTGGG + Intergenic
1107702260 13:43060171-43060193 GGGGTGGTATGGAGAGATAATGG + Intronic
1108454394 13:50598313-50598335 GGGGTGGGATGGAGAGACCTGGG - Intronic
1108803428 13:54127889-54127911 GGGGTGGTATGGAGAGATAATGG + Intergenic
1109344039 13:61093933-61093955 GGGGTGGTATGGAGAGATAATGG - Intergenic
1109353415 13:61210781-61210803 GGGGTGGTATGGAGAGATAATGG - Intergenic
1109499761 13:63218622-63218644 GGGGTGGTATGGAGAGATAATGG - Intergenic
1111361688 13:87186931-87186953 GGGGTGGTATGTAGAGATAAGGG + Intergenic
1112900565 13:104352525-104352547 GGGATGGGATGGAGTGGGATGGG - Intergenic
1113086174 13:106571513-106571535 GAGATTGGATGTAGAGGTATAGG + Intergenic
1113598999 13:111555020-111555042 TGGGTGGGATGAGGAGGTGGCGG + Intergenic
1113951243 13:114072200-114072222 GGGGTGGGATGCACAGGGACAGG - Intronic
1113966391 13:114155777-114155799 GGGGTGGGGTGCAGAGGGTTGGG + Intergenic
1114222128 14:20706065-20706087 GGGGTGGTATGGAGAGATAATGG - Intergenic
1114234893 14:20815022-20815044 GGGGTGGTATGGAGAGATAATGG + Intergenic
1114560923 14:23589787-23589809 GGGGTGGGATGCACTGGTAAAGG + Intergenic
1116011074 14:39353013-39353035 GGGGTGGGGTGAAGAGGAACTGG - Intronic
1116682630 14:47994099-47994121 GGGTAGGGGTGAAGAAGTATGGG - Intergenic
1116701948 14:48255679-48255701 GGGATGGTATGAAGAGATAATGG + Intergenic
1117133185 14:52706432-52706454 GGGGTGGGTTGTAGAGATGTGGG - Intergenic
1117766483 14:59088822-59088844 AGGGTGGGAAGAAGAGGGAGAGG - Intergenic
1118194620 14:63613046-63613068 AGGGTAGGATTAAGAGGTAATGG + Intronic
1118366443 14:65101688-65101710 GGGGAGGGAGGAAGGGGTGTCGG - Intronic
1118782380 14:69017695-69017717 GGGGTGGGGTGGAGAGGCAGGGG - Intergenic
1118782421 14:69017790-69017812 GGGGTGGGGTGGAGAGGCAGGGG - Intergenic
1118782435 14:69017822-69017844 GGGGTGGGGTGGAGAGGCAGGGG - Intergenic
1118782449 14:69017852-69017874 GGGGTGGGGTGGAGAGGCAGGGG - Intergenic
1118782477 14:69017917-69017939 GGGGTGGGGTGGAGAGGCAGGGG - Intergenic
1119559804 14:75580999-75581021 GGGGTGGTATGGAGAGATAATGG + Intronic
1119790666 14:77347059-77347081 GGGGTGGGATGGGGAGATGTTGG - Intronic
1120437643 14:84500732-84500754 GGGGTGGTATGGAGAGATAATGG + Intergenic
1120618652 14:86736555-86736577 GGGGTGGTATGGAGAGATACTGG - Intergenic
1121389203 14:93559915-93559937 GGGGTGGCATGGAGAGATAATGG + Intronic
1121980123 14:98447280-98447302 GGGGTGGTATGGAGAGATAATGG + Intergenic
1122207505 14:100155332-100155354 GGGCTGGGAGGAAGAAGTTTAGG - Intronic
1122380828 14:101305727-101305749 GGGGTGGCATGGAGAGATAATGG + Intergenic
1122508152 14:102245305-102245327 GGGGTGGTATGAAGAGATAATGG - Intronic
1125315564 15:38427573-38427595 GGTATGGGATGTAGAGGTAGGGG + Intergenic
1125513722 15:40306673-40306695 GAGGTGGGATGAGGGGGTCTGGG - Intronic
1125817992 15:42602841-42602863 GGGGTGGGATGAAGGAGTTGGGG - Intronic
1125849540 15:42889867-42889889 GGGGTGGTATGGAGAGATAATGG - Intronic
1125957494 15:43800388-43800410 GGGGTGGGCTGGAGCGGTGTCGG + Intronic
1126732130 15:51694503-51694525 GGGGGAGGATGAAGAGGAAGGGG + Intronic
1126844275 15:52744689-52744711 GGGGTGGTATGGAGAGATAATGG - Intergenic
1127026790 15:54815549-54815571 GGGGTGGGATGATACGGTTTAGG + Intergenic
1128255464 15:66192926-66192948 GTGGTGTGATGGAGAGGAATAGG + Intronic
1128570407 15:68729529-68729551 GGGGTAGGATAAAGAGTTGTAGG - Intergenic
1128788853 15:70417975-70417997 GCAGTGGGATGAAGAGGTGAAGG - Intergenic
1129259874 15:74359293-74359315 GGGGTGGTATGGAGAGATAATGG - Intronic
1129262959 15:74379070-74379092 GGTGTGGGATGAAGAGAGACAGG + Intergenic
1129295253 15:74596575-74596597 GGGGAGGGCTGAAGAGGGCTGGG - Exonic
1129828513 15:78651605-78651627 GGGCTGGGAAGTAGAGGTGTGGG - Intronic
1129964880 15:79725516-79725538 GGGCTGGGATGAGGGGGAATGGG + Intergenic
1130115870 15:81003370-81003392 GGGGGTGGAAGAAGGGGTATGGG - Exonic
1130291446 15:82605391-82605413 GGGGCGGGATAAGAAGGTATTGG + Intronic
1130711253 15:86283471-86283493 GGGGTGGGATGGGGAGGTGGGGG + Intronic
1130781528 15:87045017-87045039 GGGGTGGTATGGAGAGATAATGG - Intergenic
1131097921 15:89667535-89667557 GGGGTGAGAAGCAGAGGCATAGG - Intronic
1131165272 15:90137818-90137840 GGGGTGGTATGGAGAGATAATGG - Intergenic
1131261178 15:90888707-90888729 GCTGTGGGAAGAAGAGGTTTAGG + Intronic
1135024837 16:18991055-18991077 GGGGTGGTATGGAGAGATAATGG + Intronic
1135854344 16:25993056-25993078 GATGTGGGATGGAGAGGGATGGG + Intronic
1136106060 16:28031057-28031079 GGGATGGGATGGATTGGTATGGG + Intronic
1136106096 16:28031201-28031223 GGGGTGGGATGAGATGGAATAGG + Intronic
1136106147 16:28031361-28031383 GGGGTGGGATGAGATGGGATGGG + Intronic
1136530398 16:30864572-30864594 GGGGTGGTATGGAGAGATAATGG - Intronic
1136605161 16:31329076-31329098 GGGGTGGGGTGCAGGGGGATGGG - Intronic
1137449615 16:48559073-48559095 GGGGTGGAAAGAAGAAGTAAGGG + Intronic
1138536541 16:57663384-57663406 GGGGAGGGAGGAGGAGGGATGGG + Intronic
1139252138 16:65506603-65506625 GGGGTGAGAAGAGGAGGGATGGG - Intergenic
1139747870 16:69089001-69089023 GGGGTGGCATGAAAAGGGCTGGG - Intergenic
1140076872 16:71708112-71708134 GGGGTGGTATGGAGAGATAATGG - Intronic
1140983723 16:80137546-80137568 AGGGTGGGATGAATAGGTGCTGG - Intergenic
1141369003 16:83470158-83470180 GAGGTGGGAAGTAGAGGGATAGG - Intronic
1141891804 16:86930999-86931021 GGAGTGGGATGAAGAGGAGGAGG - Intergenic
1143395959 17:6596358-6596380 GGGGTGGGGAGGAGAGGCATGGG + Intronic
1143554178 17:7650694-7650716 AGGGTGGGAGGAAGAGATAGAGG - Intronic
1143713975 17:8753900-8753922 GGTGTGGGAGGAACAGGGATGGG - Intronic
1144094382 17:11886704-11886726 GGGATGGAGTGAAGAGGGATGGG - Intronic
1144608861 17:16690729-16690751 GGGATAGGAAGAAGAGGTAATGG + Exonic
1144903962 17:18625097-18625119 GGGATAGGAAGAAGAGGTAATGG - Intergenic
1144934173 17:18884706-18884728 AGGGAAGGATGAAGAGGTTTAGG + Intronic
1145128623 17:20321645-20321667 GGGATAGGAAGAAGAGGTAATGG + Intergenic
1145195999 17:20895670-20895692 GGGATAGGAAGAAGAGGTAATGG - Exonic
1145197061 17:20903091-20903113 GGGGTGGGAGGCAGGGGTTTGGG - Intergenic
1146300658 17:31686452-31686474 GGATTGGGATGAAGAGATACAGG + Intergenic
1146787979 17:35734876-35734898 GAGGAGGGATGGAGAGGTTTTGG + Intronic
1147419199 17:40313702-40313724 GGGGTGGGCAGCAGAGGAATAGG - Intronic
1147424578 17:40340103-40340125 GGGGTGGGGGTAAGGGGTATGGG - Intronic
1147899267 17:43773312-43773334 GGGGAGAGACGAAGAGGTAAAGG + Intronic
1148182932 17:45620094-45620116 GAGGTGGGAGGAATAGGAATAGG - Intergenic
1148246129 17:46032040-46032062 GGGGCTGGATGAACAGGTAAGGG - Exonic
1148265926 17:46225597-46225619 GAGGTGGGAGGAATAGGAATAGG + Intergenic
1148371139 17:47100515-47100537 GAGGTGGGAGGAATAGGAATAGG + Intergenic
1148382580 17:47210387-47210409 GGGGTGGGCTGAAGAGGGAGGGG + Intronic
1148684727 17:49495167-49495189 GGGGTGGGAAGCAGAGGCAAAGG - Intergenic
1149221141 17:54416300-54416322 GGGGTGGTATGGAGAGATAATGG - Intergenic
1149329562 17:55567281-55567303 GGGGTGAGATGATGAGGGAGGGG + Intergenic
1149435229 17:56628296-56628318 GGAGTGGGAGGCAGAGGTAGAGG + Intergenic
1149594789 17:57858448-57858470 GGGTTGGGATGCAGGGGGATGGG - Intergenic
1150221968 17:63500874-63500896 GGGGAGGGATGATGAGGGAGAGG - Intronic
1150458875 17:65330506-65330528 GGAGTGGGATGAAGGGGTATTGG + Intergenic
1150488634 17:65560452-65560474 GAGGTGGGATGAAAGGGTAGCGG - Intronic
1150628250 17:66857844-66857866 GGGGTGGGATGGAGTGGGCTGGG - Intronic
1151555903 17:74846627-74846649 GGGGTGGAGGGAAGAGGTCTTGG - Intronic
1151873673 17:76853737-76853759 GGGGTGCAATGAAGTGGTCTTGG + Intergenic
1152328342 17:79655823-79655845 GGGCTGGGGTGAGGAGGCATTGG - Intergenic
1152336739 17:79703157-79703179 GGGGGAGGAGGAAGAGGTAGAGG - Intergenic
1152454754 17:80407667-80407689 GGGGTGGTATGGAGAGATAATGG - Intergenic
1152635223 17:81428148-81428170 GGGGTGGGAGGAAGGGGCAGGGG - Intronic
1153188228 18:2509012-2509034 TGGGTGGGATGAGAAGGTCTTGG - Intergenic
1153881113 18:9422487-9422509 GGGGTGGTATGGAGAGATAATGG + Intergenic
1154277594 18:12975825-12975847 GGCGTGGGATGAAGAGGGACCGG + Intronic
1154297300 18:13162178-13162200 GGGGTGGGAGGAAGAGGTGGAGG - Intergenic
1154433986 18:14329942-14329964 GGGGTTGGAAGATGAGGCATAGG + Intergenic
1155174317 18:23289556-23289578 GGGGTGGTATGGAGAGATAATGG - Intronic
1155218320 18:23662619-23662641 GGGGTGGGATGGGGTGGGATGGG - Intronic
1155365966 18:25049354-25049376 GGGGTTGGCTCAAGAGGTAGTGG - Intergenic
1155629690 18:27878016-27878038 GGGGTGGGAGGAGGAGGAAGAGG - Intergenic
1155892259 18:31284673-31284695 GGGGTGGTATGGAGAGATAATGG + Intergenic
1155942035 18:31809560-31809582 GGGGTGGTATGGAGAGATAATGG - Intergenic
1156251485 18:35356625-35356647 GGGGTGGTATGGAGAGATAATGG + Intergenic
1156463023 18:37332293-37332315 GGGGTGGGACGCAGTGGTCTCGG + Intronic
1156641907 18:39111936-39111958 GGGCTGGAAAGAAGAAGTATTGG - Intergenic
1156938940 18:42741849-42741871 GGGGTGGTATGGAGAGATAATGG - Intergenic
1157447284 18:47755045-47755067 GGGGTGGGATGAGGATGGGTGGG + Intergenic
1157477785 18:48034499-48034521 GGGCTGGGAGGAAGAGGGCTGGG - Intronic
1158382701 18:56951377-56951399 AGGGTGTGAGGAAGAGGTACGGG - Intronic
1158663779 18:59414063-59414085 CTGGTGGGATAAAGAGTTATTGG - Intergenic
1159929783 18:74298592-74298614 GGGGTGGTATGGAGAGATAATGG - Intergenic
1160448612 18:78946931-78946953 GGGGAGGGAGGAAGAGGGAAAGG + Intergenic
1160891844 19:1383177-1383199 GGGGTGGGAAGAGGAGGCTTTGG + Intergenic
1160905688 19:1450701-1450723 GGGGAGGGAGGCACAGGTATGGG - Intronic
1161612687 19:5251775-5251797 AGGGTGGGATGAGAAGGTCTGGG + Intronic
1161711280 19:5849683-5849705 GGGGTGGTATGGAGAGATAATGG - Intronic
1161786135 19:6326857-6326879 GGGGAGAGATGAAGACGTAACGG - Intronic
1161810362 19:6467856-6467878 GGGGTGAGATGAAGAATTAGGGG + Exonic
1161827295 19:6576790-6576812 GGGGTGGTATGGAGAGATAATGG - Intergenic
1162059693 19:8087070-8087092 GGGGAGGGCTGCACAGGTATGGG - Exonic
1162979647 19:14230363-14230385 GGGGAGGGAAGAAGAGATCTTGG + Intergenic
1163599586 19:18240793-18240815 GGGGTGGGAGGAAGAGGGTGCGG + Intronic
1163943989 19:20519295-20519317 GGGGTGGTATGGAGAGATAATGG + Intergenic
1165122746 19:33571956-33571978 GAGGAGGGATGAAGATGTATAGG + Intergenic
1165137656 19:33680040-33680062 GGAGTGGGAAGAAGTGGAATAGG - Intronic
1165496596 19:36155974-36155996 GGGGTGGTATGAAGAGAGAATGG + Intergenic
1165509915 19:36260002-36260024 GGGGTGGTATGAAGAGAGAATGG + Intergenic
1165835770 19:38754796-38754818 GGGGTGGTATGGAGAGATAATGG - Intronic
1166022617 19:40046109-40046131 GGTGGGGGATGAAGAGGAGTTGG + Intronic
1166085633 19:40472808-40472830 GGGGTGGGATGAGGAGGAGGGGG + Intronic
1166396839 19:42447439-42447461 GGGGTGGTATGGAGAGATAATGG + Intergenic
1166516285 19:43449514-43449536 GGGGTGGGAAGAGGAGGCAGAGG - Intergenic
1166563466 19:43748650-43748672 GGGGAGGCATGAAGAGGTCAAGG - Intronic
1166905127 19:46102829-46102851 GGGGTGGTATGGAGAGATAATGG + Intergenic
1166926669 19:46273677-46273699 GGGGTGGTATGGAGAGATAATGG + Intergenic
1167270474 19:48503033-48503055 GGGGCAGGATGAAGAGGAAGGGG - Intronic
1167321897 19:48802021-48802043 GGGCTGGGAAGAAGAGGCAGGGG - Intronic
1167550209 19:50155064-50155086 GGGGTGGGGTGAGGAGGACTTGG + Intronic
1167704873 19:51075595-51075617 GGGGTGGGAGGATGAGGAAAAGG + Intergenic
1167901648 19:52626801-52626823 GGGGTGGTATGGAGAGATAATGG - Intronic
1168227574 19:55007311-55007333 GGGGTGGTATGGAGAGATAATGG + Intergenic
1168240704 19:55087469-55087491 GGGTTGGGATGACGAGGGCTCGG + Intronic
1168248814 19:55129063-55129085 GGGGTGGTATGGAGAGATAACGG - Intergenic
1168347990 19:55660150-55660172 GGGGTGGGAGGGAAAGGTATGGG - Intronic
1168383266 19:55942217-55942239 GGGGTTGGATGAAGAGCGGTTGG - Intergenic
925900912 2:8508883-8508905 GGGGTGGCATGGCGAGGAATGGG - Intergenic
927009227 2:18884818-18884840 GGTAGGGGATAAAGAGGTATTGG + Intergenic
927113288 2:19879268-19879290 GAGGTGGGATGAAGCAGCATGGG - Intergenic
927826867 2:26315422-26315444 GGCGTGGGAAGAAGAGGTGAAGG + Intronic
928169846 2:28996376-28996398 GGGGTGGAATGAAGAGAGGTTGG - Intronic
928181914 2:29073953-29073975 CAGCTGGGATGAAGAGGTTTTGG + Exonic
928613164 2:33010379-33010401 TGGGGGGGATGAAGAGAAATTGG + Intronic
928680014 2:33692312-33692334 GGGGTGGGATGATATGGTTTGGG - Intergenic
928778811 2:34795553-34795575 GGGGTGGTATGGAGAGATAATGG - Intergenic
928827215 2:35437399-35437421 GGGGTGGTATGGAGAGATAATGG + Intergenic
928857599 2:35818277-35818299 GGGGTGGTATGGAGAGATAATGG - Intergenic
929076259 2:38081275-38081297 GGGGTGGTATGGAGAGATAATGG + Intronic
929273519 2:40000326-40000348 GGGGTGGGGAGATGAGGGATAGG - Intergenic
929384251 2:41385192-41385214 GGGGTGGTATGGAGAGATAATGG - Intergenic
929429982 2:41878752-41878774 GGGATGGGAGGAGGAGGGATGGG - Intergenic
929919441 2:46161946-46161968 GGGGTGAGGTGAACAGGTGTGGG + Intronic
930706202 2:54507364-54507386 GGGGTGGTATGGAGAGATAATGG + Intronic
930958894 2:57234751-57234773 GGGGTGGTATGGAGAGATAATGG - Intergenic
931055814 2:58469992-58470014 GGAGTAGTATGAAGAGGTCTGGG - Intergenic
931329888 2:61270041-61270063 GGGATGGGATGAAGAGAGATTGG - Intronic
931415394 2:62075687-62075709 GGGGTGGGAGCCAGAGGTCTAGG - Intronic
931608471 2:64075240-64075262 GGGGTGGTATGGAGAGATAATGG + Intergenic
931648427 2:64446728-64446750 GGCAGGGGATGAAGAGGGATTGG + Intergenic
931924324 2:67054808-67054830 GGGGAGGGGTGAAGGGGGATAGG - Intergenic
931948690 2:67337059-67337081 GGGGTGGTATGGAGAGATAATGG - Intergenic
932066082 2:68562235-68562257 GGGGTGGGTTGGAGAGGTATTGG + Intronic
932389947 2:71378889-71378911 GGGATGGAGTGAAGAAGTATAGG + Intronic
932724042 2:74162137-74162159 GGAGTGGGATTAAGAGGTGGTGG + Intronic
934153109 2:89168616-89168638 TGGTTGGAATGAAGAGTTATTGG - Intergenic
934214131 2:90013315-90013337 TGGTTGGAATGAAGAGTTATTGG + Intergenic
934554134 2:95278509-95278531 GGGGTAGGAAGAAGAGGTCCGGG + Intronic
936866113 2:117077568-117077590 GGGGTGGGATGAGAGGGGATGGG - Intergenic
936871067 2:117134617-117134639 GGGGTGGTATGGAGAGATAATGG - Intergenic
937731249 2:125233009-125233031 GAAGTGGGAGGAAGAGGTGTTGG - Intergenic
937993174 2:127675210-127675232 GGGGTGGGATGGGGAGGTCAAGG + Intronic
939528848 2:143331292-143331314 GGGATGGGAAGAAGAGCGATCGG - Intronic
939902773 2:147870024-147870046 GGGGCTGTATGAAGGGGTATAGG + Intronic
940107811 2:150118015-150118037 GGGGTGGTATGGAGAGATACCGG - Intergenic
940212740 2:151272922-151272944 GGGGCTGGAAGAAGAGGTAATGG + Intronic
940217350 2:151314703-151314725 GGGGTGGTATGGAGAGATAATGG - Intergenic
940508264 2:154583121-154583143 GGGGTGGTATGGAGAGATAATGG + Intergenic
940675404 2:156720569-156720591 GGGGTGGTATGGAGAGATAATGG + Intergenic
941935434 2:170977933-170977955 GGGGTGGCATGGAGAGATAATGG + Intergenic
942132932 2:172898540-172898562 TGGGTGAGATGAACAGGCATTGG + Intronic
943450602 2:188038631-188038653 GGGGTGGTATGGAGAGATAATGG - Intergenic
943460702 2:188169173-188169195 GGGGTGGTATGGAGAGATAATGG + Intergenic
943461332 2:188173611-188173633 GGTGTGAGCTGAAGAGGTTTTGG + Intergenic
943865893 2:192924320-192924342 GGGGTGGTATGGAGAGATAATGG - Intergenic
943880531 2:193139356-193139378 GGGGTGAGATGAAAAGATGTTGG + Intergenic
943908244 2:193528840-193528862 TGGGTGGGATGAAGGGGTCAAGG + Intergenic
944251927 2:197587263-197587285 GGGGTGGTATGGAGAGATAATGG - Intronic
945173911 2:207022777-207022799 GGGGTGGTATGGAGAGATAATGG - Intergenic
945301017 2:208216413-208216435 GGGGTGGTATGGAGAGATAATGG + Intergenic
945555178 2:211267183-211267205 GGGGTGGTATGGAGAGATAATGG - Intergenic
945688025 2:212996278-212996300 GGGGTGGGGTGAGGAGGAGTGGG + Intergenic
946208842 2:218130951-218130973 GGGGTGGGCTGGAGGTGTATGGG - Intronic
946331090 2:219009707-219009729 GGGGTGGGATGGAGTAGAATGGG + Intronic
946837376 2:223785755-223785777 GGGGAGGGATGAATAGGTGGAGG + Intronic
946886917 2:224230491-224230513 GGGATGGGATGGAGAGATAATGG - Intergenic
947739912 2:232480333-232480355 GGGGTGGGATCAGGGGGCATGGG - Intronic
947842303 2:233215618-233215640 GGGGTGGTATGGAGAGATAATGG + Intronic
947881207 2:233514908-233514930 TGGGAGGGAGGAAGAGGGATTGG - Intronic
1169971828 20:11276914-11276936 GGGGTGGGTGGAAGAAGTTTGGG + Intergenic
1171096879 20:22340783-22340805 AGGGAGGGATGAATAGGTACAGG + Intergenic
1171204258 20:23266883-23266905 GGGGTGGGAGGAAGGGGATTGGG + Intergenic
1172054834 20:32146872-32146894 GGGGAGGGATGAAGTTGGATGGG + Intronic
1173575959 20:44113101-44113123 AGGGTGGGAGGAAGGGGGATGGG + Exonic
1173763365 20:45584728-45584750 GGGGTGGTATGGAGAGATAATGG + Intergenic
1174812082 20:53654677-53654699 GGGGTGGGATGAGGTGGTTCAGG + Intergenic
1175642659 20:60643837-60643859 GGGGTGGGACGAAGTGGAATTGG - Intergenic
1175935113 20:62510589-62510611 GTGGAGGGATGGAGAGGTAGAGG - Intergenic
1176756786 21:10731506-10731528 GGGGTGGAATGGAGTGGAATGGG - Intergenic
1177026133 21:15924058-15924080 GGAGTGGGGTGAAAAGATATAGG - Intergenic
1178001620 21:28166401-28166423 GGGGTGGTATGGAGAGATAATGG - Intergenic
1178236608 21:30850090-30850112 GGGGTGGGGAGTGGAGGTATAGG + Intergenic
1178928426 21:36794996-36795018 GGAGTGGGAGGGAGAGGTCTGGG + Intronic
1179059248 21:37964614-37964636 GGGGTGGCATGAGGAAGTATTGG + Intronic
1179649902 21:42801369-42801391 GGGGTGGTATGGAGAGATAATGG + Intergenic
1179881278 21:44294269-44294291 GGGGTGTGAGGAAGGGGTGTGGG - Intronic
1180158924 21:45990448-45990470 GGGGAGGGACGAGGAGGAATGGG + Intronic
1181522278 22:23456523-23456545 GGGGTGGTGTGAAGAGGTGGAGG - Intergenic
1181772766 22:25138783-25138805 TTGGTGGGTTGAAGAGATATGGG - Intronic
1181976908 22:26736738-26736760 GGGGTGGGATGAGAAGGCATGGG - Intergenic
1182048960 22:27298792-27298814 GGGGCAGGAGGAAGAGGGATAGG + Intergenic
1182854742 22:33507033-33507055 GGAGTGGGAAGAAGAGGTAAGGG + Intronic
1182977717 22:34639018-34639040 GGGGGGGGATGGGGAGGGATGGG - Intergenic
1183034493 22:35130955-35130977 GGGGTGGGTTGAGGAGGGAGAGG + Intergenic
1183635069 22:39056754-39056776 GGGGTGGTATGGAGAGATAATGG + Intronic
1183636493 22:39066544-39066566 GGGGTGGTATGGAGAGATAATGG + Intronic
1183715031 22:39528548-39528570 GGGGTGGGATCAGGAGGTGAAGG - Intergenic
1183846187 22:40542190-40542212 GGGGTGGGAGGAGGAGGCAGAGG - Intronic
1184073388 22:42161094-42161116 GGGGTGGGATGATGGGGAAAGGG - Exonic
1184551809 22:45208613-45208635 GGGGTGGGGTGAAGGGGCCTCGG + Intronic
1184561643 22:45267272-45267294 GAGGGGGGATGAAGAGGGAATGG + Intergenic
1184693302 22:46127163-46127185 GGGATGGGCTGAAGAGGTTGTGG + Intergenic
949876832 3:8631718-8631740 GGGGTGGCATGAGGGGGTGTAGG + Intronic
950327436 3:12124837-12124859 GGGAAGGGATGTAGAGGAATAGG + Intronic
950545518 3:13635911-13635933 GGGGTGGGATGGAGGGTGATGGG + Intronic
951331822 3:21378387-21378409 GGGGTGGTATGGAGAGATAATGG + Intergenic
951780377 3:26356349-26356371 GGGGTGGCAGGAAGAGGTACAGG + Intergenic
951888744 3:27550075-27550097 GGGGTGGTATGGAGAGATAATGG + Intergenic
951895088 3:27602604-27602626 GGGGTGGTATGGAGAGATAATGG - Intergenic
952663051 3:35874837-35874859 GGGGTGGTATGGAGAGATAATGG + Intergenic
952729000 3:36619579-36619601 GGAGTGGTAGGAAGGGGTATTGG - Intergenic
952792274 3:37209420-37209442 GGGGTGGTATGGAGAGATAATGG - Intergenic
952855163 3:37764301-37764323 GGGGTTGGATGAAGAGGCACAGG - Intronic
953076722 3:39578315-39578337 GGGGTGGTATGGAGAGATAATGG + Intergenic
953177602 3:40566176-40566198 GGGGTGGTATGGAGAGATAATGG - Intronic
953293317 3:41688176-41688198 GGGGTGGGATGAGGATGGAGGGG - Intronic
953833961 3:46327248-46327270 GGGGTGGTATGTAGAGATAAGGG + Intergenic
953840730 3:46388199-46388221 GGGGTGGTATGGAGAGATAATGG + Intergenic
954222069 3:49161010-49161032 GGGGTGGGGTGGAGAGGGGTGGG - Intergenic
954386808 3:50248456-50248478 TGGGTGGGGTGAAGAGCTCTCGG - Intronic
954674231 3:52306914-52306936 GGGGTGGGGTGAGGTGGTCTTGG - Intergenic
955287000 3:57651501-57651523 GGGCTGGGAAGAAGAGGGAATGG + Intronic
955401531 3:58595173-58595195 GGGGTGGTATGGAGAGATAATGG - Intronic
955470654 3:59282941-59282963 GAGTTGGGATGAAGACATATAGG + Intergenic
955565688 3:60242608-60242630 GGGAAGAGGTGAAGAGGTATTGG - Intronic
955961473 3:64345352-64345374 GGGGTGGGGTGGAGAGGAAGAGG - Intronic
957734301 3:84187306-84187328 GGGGTGGCATGGAGAGATAATGG + Intergenic
957734435 3:84188260-84188282 GGGGTGGTATGGAGAGATAATGG + Intergenic
958422459 3:93943586-93943608 GGGGTGGTATGGAGAGATAATGG - Intronic
958676294 3:97272934-97272956 GGGGTGGTATGGAGAGATAATGG + Intronic
959485350 3:106923241-106923263 GGGGTGGTATGGAGAGATAATGG + Intergenic
959839308 3:110956029-110956051 GTGGAGGGAGGAAGAGGTGTGGG - Intergenic
959855524 3:111151863-111151885 GGGGTAGGGTAAATAGGTATAGG - Intronic
960715479 3:120570800-120570822 GGGCTGGGAAGAAGAGGAAATGG + Intergenic
961712248 3:128836585-128836607 GGGGTGGTATGGAGAGATAATGG + Intergenic
961891999 3:130138114-130138136 GGGGTGGTATGGAGAGATAATGG + Intergenic
962025499 3:131542819-131542841 GGGGGGGGGTGAAGAGGTGAGGG + Intronic
962523468 3:136217975-136217997 GGGGTGGTATGGAGAGATAATGG + Intergenic
962679039 3:137779996-137780018 GTGGTGGGATGAAGGGGAAATGG + Intergenic
963320579 3:143805378-143805400 GGGGTGGCATGGAGAGATAATGG - Intronic
963361030 3:144271967-144271989 TGGGTGGAATGAAGATGAATAGG - Intergenic
963902978 3:150750000-150750022 GAAGTGGGAAGAAGAGATATAGG + Intronic
964607236 3:158571969-158571991 GGGGTGGGAGGAGGAGGGTTTGG + Intronic
964989060 3:162783954-162783976 GGGATGGGGGGAAGAGGAATGGG + Intergenic
965104831 3:164342661-164342683 GGGGTGGTATGGAGAGATAATGG + Intergenic
965255475 3:166402898-166402920 AGAGATGGATGAAGAGGTATTGG - Intergenic
965335901 3:167430682-167430704 GGGGTGGTATGGAGAGATAATGG - Intergenic
965458387 3:168931351-168931373 GAGGTGGTATGAAGAGATAATGG + Intergenic
965624423 3:170672662-170672684 GGGGTGGTATGGAGAGATAATGG + Intronic
966397158 3:179515767-179515789 GGGGTGGTATGGAGAGATAATGG + Intergenic
966765337 3:183456913-183456935 GGTGTGGGATGGAGAAGTGTGGG - Intergenic
967145715 3:186604301-186604323 TGGGTGGGAGGAAGAGGTGTGGG - Intergenic
967881915 3:194307528-194307550 GGGGTGGGAACAAGCGGTTTGGG - Intergenic
969003382 4:4000563-4000585 GGGGTGGTATGGAGAGATAATGG + Intergenic
969527758 4:7712708-7712730 GGGGTGGGAAGAGGAGGGAAGGG - Intronic
969653605 4:8482913-8482935 GGGGTGGTATGGAGAGATAATGG + Intronic
969810547 4:9644262-9644284 GGGATGGTATGGAGAGGTAATGG - Intergenic
970042475 4:11811484-11811506 GGGGTGGTATGGAGAGATAATGG - Intergenic
970087987 4:12369182-12369204 GGGGTGGTATGGAGAGATAATGG - Intergenic
970657641 4:18249136-18249158 GGGGTCGGAGGATGAGGTAGAGG + Intergenic
970938689 4:21605869-21605891 GGGGTGGGAGGAGGAGTTAGTGG + Intronic
971341966 4:25778849-25778871 GGGGTGGGATGAAGTGAGGTAGG + Intronic
971553377 4:27980868-27980890 GGGGTGGTATGGAGAGATAATGG - Intergenic
972070875 4:35018640-35018662 GGGGTGGTATGGAGAGATAATGG - Intergenic
972599210 4:40556921-40556943 GAGGTGGGATGAAGAGCTGCAGG + Intronic
972793527 4:42395055-42395077 GGGGTATTATGAAGAGGTTTTGG - Intergenic
972828662 4:42788939-42788961 GGTCAGGGATGAAGAAGTATGGG + Intergenic
973598033 4:52512703-52512725 GGGGTGGGTTGCAGGGGTACAGG + Intergenic
973678519 4:53291032-53291054 TGTGTGGGCTTAAGAGGTATTGG - Intronic
973712165 4:53640978-53641000 TGTTTGGGATGAAAAGGTATTGG + Intronic
975198925 4:71562188-71562210 AGGGTAGGATGAAGAGGAAGAGG - Intronic
975592549 4:76015282-76015304 GGGGAGGGATGCAGATGTATAGG + Intronic
976559035 4:86479968-86479990 GGGGTGGTATGGAGAGATAATGG - Intronic
976739353 4:88342684-88342706 GGGGTGGTATGGAGAGATAATGG - Intergenic
977530738 4:98197975-98197997 GTTCTGGGAAGAAGAGGTATTGG + Intergenic
978031934 4:103946497-103946519 GGGGTGGCATGGAGAGATAATGG - Intergenic
978777684 4:112519354-112519376 GGGGTGGGGGGAAGAGGGCTGGG + Intergenic
978798888 4:112735836-112735858 GGGCTGGGATGAGGAGGAAATGG - Intergenic
979036476 4:115726036-115726058 GGAGAGGGATGAATAGGTATAGG + Intergenic
979170932 4:117600642-117600664 GGGGTGGTATGGAGAGATAATGG + Intergenic
980064274 4:128166721-128166743 AGGGTGGGATGAAGGAGAATGGG - Intronic
980111495 4:128641374-128641396 GGGGTGGTATGGAGAGATAATGG + Intergenic
980302443 4:131011827-131011849 GGGGTGGTATGGAGAGATAATGG - Intergenic
980389338 4:132123384-132123406 GGGGTGGTATGGAGAGATAATGG - Intergenic
980471981 4:133264034-133264056 GGGGTGGTATGGAGAGATAATGG + Intergenic
980528334 4:134017878-134017900 GGGGTGGTATGGAGAGATAATGG - Intergenic
981475944 4:145187076-145187098 AGGGTGGAATCAAGAGGTAGTGG - Intergenic
981482470 4:145253143-145253165 GGGGTGGTATGGAGAGATAATGG + Intergenic
981680952 4:147397188-147397210 GGGATGGGTTGAAGAGATGTTGG + Intergenic
981889034 4:149714892-149714914 TGGGTGGGATTAATTGGTATGGG + Intergenic
982319455 4:154063294-154063316 GGGGTGGTATGGAGAGATAATGG - Intergenic
983056085 4:163100446-163100468 GGGGTGGTATGGAGAGATAATGG + Intergenic
983707976 4:170681838-170681860 GGGGTGGTATGGAGAGATAATGG - Intergenic
983779888 4:171655439-171655461 AGGATGGGATGAGGAGGTGTTGG - Intergenic
983805378 4:171986539-171986561 GGGGTGGTATGGAGAGATAATGG + Intronic
984164840 4:176294714-176294736 GGGGTGGTATGGAGAGATAATGG + Intergenic
984852134 4:184163377-184163399 TGGGTGGGGTGAAGAAGTAAAGG + Intronic
985078527 4:186242396-186242418 GGGGTGGTATGGAGAGATAATGG + Intronic
985389467 4:189480059-189480081 GGGGTGGTATGAAGAGAGAATGG + Intergenic
985436169 4:189931361-189931383 GGGGTGGTATGGAGAGATAATGG - Intergenic
986554603 5:8998843-8998865 GGGGTGGTATGGAGAGATAATGG + Intergenic
987241223 5:16002017-16002039 GGAGGGGAATGAAGAGGGATAGG - Intergenic
987241962 5:16009061-16009083 GGGAGAGGAGGAAGAGGTATGGG + Intergenic
987282409 5:16424920-16424942 GGGGTGGTATGGAGAGATAATGG - Intergenic
987821822 5:22974815-22974837 GGGGTGGTATGGAGAGATAATGG - Intergenic
989687934 5:44110926-44110948 GGGGTGGTATGGAGAGATAATGG + Intergenic
990528617 5:56652493-56652515 AGGGAGGGATGAATAGGTATAGG + Intergenic
990564634 5:57016981-57017003 GGGGTGGTATGGAGAGATAATGG + Intergenic
991278226 5:64877421-64877443 TGGGGGGGATGAAGAGAGATTGG + Intronic
991515039 5:67425815-67425837 TGGGGAGGATGGAGAGGTATTGG + Intergenic
991522554 5:67516733-67516755 GGAGTGGGATGAGGTGGTCTAGG + Intergenic
991585025 5:68193289-68193311 GGGGTGGGGTGAGGAGGGCTGGG - Intronic
992251783 5:74883226-74883248 GGGGTGGTATGGAGAGATAATGG + Intergenic
992451519 5:76880406-76880428 GGGGTGGTATGGAGAGATAATGG + Intronic
992664459 5:78993233-78993255 TGGGTGGGATGAAGTGGTCAAGG - Intergenic
992961282 5:81958729-81958751 GGGGTGGTATGGAGAGATAATGG - Intergenic
993051014 5:82925967-82925989 GGTTTGGGATGAAGAGGTAGAGG - Intergenic
993371400 5:87097124-87097146 ATGGTGGGATGAAGAGAAATAGG - Intergenic
993478019 5:88388827-88388849 GAGGTGGGAGGAAGAGGTGGAGG + Intergenic
994000112 5:94769236-94769258 CGGGTGGGGTGAAGAGAGATTGG + Intronic
994191490 5:96874448-96874470 GGGGCAGGTAGAAGAGGTATAGG - Intronic
994295625 5:98084819-98084841 GGGGTGGTATGGAGAGATAATGG - Intergenic
994455845 5:100006702-100006724 GGAGAGGGATGAAGAGAAATTGG - Intergenic
994776089 5:104036809-104036831 GGGGTGGTATGGAGAGATAATGG - Intergenic
995100043 5:108289541-108289563 GGGATGGTATGAGAAGGTATGGG + Intronic
995297067 5:110535025-110535047 GGGGTGGTATGGAGAGATAATGG - Intronic
995769664 5:115654553-115654575 GGGGTGGTATGGAGAGATAATGG - Intergenic
996357946 5:122617424-122617446 GGGGTGGCATGGAGAGATAATGG + Intergenic
996460875 5:123741382-123741404 GGGGTGGCAGGAACAGGTCTGGG + Intergenic
996510310 5:124308967-124308989 GGGGTGGTATGGAGAGATAATGG - Intergenic
996918186 5:128735472-128735494 GGGGTGGTATGGAGAGATAATGG - Intronic
996921221 5:128769846-128769868 GGGGTGAGATGAAAAGGGAAGGG + Intronic
997022476 5:130017442-130017464 GTGGTGGGATGGAGGGGTCTGGG + Intronic
997206816 5:132054950-132054972 TGGGGGGGATGATGAGGTGTGGG + Intergenic
998392884 5:141798782-141798804 GGAGTGAGAGGAGGAGGTATGGG - Intergenic
998511457 5:142717856-142717878 GTGGTGGGATGAAGTGGCTTTGG + Intergenic
998693276 5:144611833-144611855 GGGGTGGTATGGAGAGATAATGG + Intergenic
999242983 5:150138287-150138309 GGGGTGAGATGGGGAGGTAGGGG - Intronic
999697907 5:154202739-154202761 GGGGTGGCAGGAAGAGTTATGGG - Intronic
1000440219 5:161254511-161254533 GGGGTGGTATGGAGAGATAATGG - Intergenic
1000518985 5:162275913-162275935 GGGGTGGTATGGAGAGATAATGG + Intergenic
1000607492 5:163340127-163340149 GGGGTGGTATGAAGAGATAATGG - Intergenic
1000935152 5:167298111-167298133 GGGGTGGGATGGAGAGATAATGG + Intronic
1001069527 5:168572821-168572843 GGGGTGGTATGGAGAGATAATGG + Intronic
1001449291 5:171811985-171812007 CAGGTGGGAAAAAGAGGTATCGG - Intergenic
1002200645 5:177525924-177525946 GAGGTGGGATGGAGAGGTTGGGG - Intronic
1002974854 6:2064603-2064625 AGAGTGGGATGAAGGGGCATGGG - Intronic
1003100554 6:3173350-3173372 GGGGTGGTATGGAGAGATAATGG - Intergenic
1003161054 6:3634686-3634708 GGGCTGGGATGAGGAGGGAAAGG + Intergenic
1003172350 6:3729800-3729822 GGGGTGGGAGAAAGGGGGATGGG - Intronic
1003392865 6:5728449-5728471 GGGAGGGGGTGAGGAGGTATAGG + Intronic
1004312344 6:14556522-14556544 GGGGTGGGAGGATAAGGAATAGG + Intergenic
1004497015 6:16174290-16174312 GGGGAGGGAGGATGTGGTATAGG - Intergenic
1004732352 6:18370216-18370238 TGGGTGGGATGAAGAGCTATTGG + Intergenic
1005785914 6:29245992-29246014 GGGGTGGTATGGAGAGATAATGG + Intergenic
1006056590 6:31389661-31389683 GGGCTGGGAGGCAGAGGTGTAGG - Intergenic
1006069313 6:31486640-31486662 GGGCTGGGAGGCAGAGGTGTGGG - Intergenic
1006187342 6:32188927-32188949 GGGGTGGAATGAGGAGTTCTTGG + Intronic
1006298152 6:33179144-33179166 GGGGTGGGGTTAGGAGGCATAGG + Intronic
1007084244 6:39132021-39132043 GGGGTGGTATGGAGAGATAATGG + Intergenic
1007300165 6:40861905-40861927 GGGGTGGCATGGAGAGATAATGG + Intergenic
1008141764 6:47840049-47840071 GGGGTGAGGTGAAGAGGTGGGGG + Intergenic
1008457367 6:51726550-51726572 GGAGGGGGATGAAGCGGTAATGG - Intronic
1008477055 6:51943887-51943909 GGGGTGGTATGGAGAGATAATGG - Intronic
1008944546 6:57083272-57083294 GGGGTGGGAGCAAGTGGTCTTGG + Intergenic
1009343997 6:62591233-62591255 GGGGTGGTATGGAGAGATAATGG - Intergenic
1009464864 6:63956068-63956090 GGGGTGGTATGGAGAGATAATGG - Intronic
1010273737 6:73945164-73945186 GTGGGAGGATGAAGAGATATTGG - Intergenic
1010566501 6:77420815-77420837 GGGAGGGGATGGAGAGATATTGG + Intergenic
1010829229 6:80510278-80510300 GGGGTGGTATGGAGAGATAATGG + Intergenic
1010840854 6:80648019-80648041 GGGGTGGTATGGAGAGATAATGG + Intergenic
1012122941 6:95389658-95389680 GGGGAGGGATGAATAGGTAGAGG - Intergenic
1012244047 6:96906342-96906364 GTGGTGGAATGAAGAGGGATGGG + Intergenic
1012318732 6:97815426-97815448 GGGGTGGGGTGGAGAGGAAAAGG - Intergenic
1012710311 6:102593358-102593380 AGGGTGGGATGAAGAGAGATTGG + Intergenic
1012737863 6:102973865-102973887 GGGGTAGTATGAAGAGGAACTGG - Intergenic
1012986280 6:105879461-105879483 GTAGTGGGATGAAGAGGGGTTGG + Intergenic
1013407475 6:109856259-109856281 GGGGTGGTATGGAGAGATAATGG + Intergenic
1013647685 6:112161709-112161731 GGGGTGGGATGAGGAGTGAGTGG + Intronic
1014114785 6:117659300-117659322 GGGGTGGTATGGAGAGATAATGG + Intergenic
1014396484 6:120930372-120930394 GGGGTGGTATGGAGAGATAATGG - Intergenic
1015662595 6:135591899-135591921 GGGAAGGGAGGAAGAGGAATGGG - Intergenic
1015857832 6:137644569-137644591 GGGGGGAGATGAAGAGAAATGGG - Intergenic
1016113732 6:140257977-140257999 GGGGTGGTATGGAGAGATAATGG + Intergenic
1016260489 6:142163690-142163712 GGGGTGTGGGGAAGAGGCATGGG + Intronic
1016268638 6:142261463-142261485 GGGGTAGGAAGAAAAGTTATAGG + Intergenic
1016535341 6:145103662-145103684 GGGGTGGTATGGAGAGATAGTGG + Intergenic
1016751029 6:147631033-147631055 GGGGTGGTATGGAGAGATAATGG + Intronic
1016894126 6:149036082-149036104 GGAGTGGGAAGGAGAGGTATGGG - Intronic
1016992529 6:149940082-149940104 GGGGTTGGGTGAAGAGGCAGAGG - Intergenic
1016999374 6:149985478-149985500 GGGGTTGGGTGAAGAGGCAGAGG - Intergenic
1017007205 6:150036539-150036561 GGGGTTGGGTGAAGAGGCAGAGG + Intergenic
1017181462 6:151556860-151556882 GAGGAGGGATGAAGAGAGATTGG - Intronic
1017556742 6:155579829-155579851 GAGATGGGATGAAGGGATATGGG + Intergenic
1017563615 6:155660558-155660580 GGGGTGGCACGGAGAGGTTTGGG + Intergenic
1017778931 6:157701163-157701185 GGGGTGGCATGGAGAGATAATGG + Intronic
1017921990 6:158880880-158880902 GGGGTGGTATGGAGAGATAATGG + Intronic
1018136225 6:160780582-160780604 GGGGTGGTATGGAGAGATAATGG - Intergenic
1019589057 7:1820067-1820089 GGGGTGGCGTGAAGAGGTGGAGG + Intronic
1020322339 7:6948674-6948696 GGGGTGGTATGGAGAGATAATGG + Intergenic
1020562833 7:9752417-9752439 TGTGTGTGATGAAGAGCTATTGG - Intergenic
1020919201 7:14240616-14240638 GGGGAGGGAAGAAAAGGTAAGGG - Intronic
1021173261 7:17420237-17420259 GGGGTGGTATGGAGAGATAATGG - Intergenic
1021394088 7:20126004-20126026 GGGGTGGTATGGAGAGATAATGG - Intergenic
1021430331 7:20551193-20551215 GGGGTGGTATGGAGAGATAATGG - Intergenic
1021661081 7:22918457-22918479 GGGGTGGTATGGAGAGATAATGG - Intergenic
1022447897 7:30484823-30484845 GGGGTGGTATGGAGAGATAATGG - Intergenic
1022572345 7:31467335-31467357 GGGGTGGTATGGAGAGATAATGG + Intergenic
1022622217 7:31996267-31996289 GGGCTGGGCTGGAGGGGTATGGG - Intronic
1022709514 7:32837777-32837799 GGGGTGGTATGGAGAGATAATGG - Intergenic
1024991073 7:55234835-55234857 GGGTTGGGATCAAGAGGTAATGG + Intronic
1025189255 7:56884204-56884226 GGGGTGGGATGGACAGGTGTAGG - Intergenic
1025198769 7:56949627-56949649 GGGGTGGGAGGAGGAGGGAGAGG - Intergenic
1025673177 7:63627306-63627328 GGGGTGGGAGGAGGAGGGAGAGG + Intergenic
1025682685 7:63692713-63692735 GGGGTGGGATGGACAGGTGTAGG + Intergenic
1027158895 7:75788068-75788090 GGGGTGGTATGGAGAGATAATGG - Intronic
1028086525 7:86644131-86644153 GGAGTGGGGTGAAGGGGCATGGG - Exonic
1028589368 7:92479660-92479682 GGGGTGGTATGGAGAGATAATGG + Intergenic
1028903059 7:96122563-96122585 GGGGTGGGAGGTGGAGGTTTCGG + Intronic
1029084099 7:97997885-97997907 GGGGTGGGATCCAGAGTTATGGG + Intergenic
1029222607 7:99002389-99002411 GGTGTGGGAGGAAGAGGGTTAGG + Intronic
1029317702 7:99729413-99729435 GGGGTGGTATGGAGAGATAATGG - Intronic
1029500674 7:100927510-100927532 GGGGTGGTATGGAGAGATAATGG - Intergenic
1030163083 7:106528255-106528277 GGGGTGGTATGGAGAGATAATGG + Intergenic
1030172403 7:106616520-106616542 GGGGGAAGAGGAAGAGGTATGGG + Intergenic
1030646773 7:112070277-112070299 GGGGTGGGAGGAAGAAGGAAGGG + Intronic
1031354718 7:120777098-120777120 GGGGTGGTATGGAGAGATAATGG + Intergenic
1031421996 7:121564121-121564143 GGGGTGGTATGGAGAGATAATGG + Intergenic
1031686254 7:124734229-124734251 GGGGTGGTATGGAGAGATAATGG - Intergenic
1031704162 7:124961141-124961163 GGGGTGGTATGGAGAGATAATGG + Intergenic
1031777864 7:125923605-125923627 GGGGTGGTATGGAGAGATAATGG - Intergenic
1032195990 7:129788889-129788911 GAGGTGGGAGGAAGAGGAAGAGG - Intergenic
1032470548 7:132175271-132175293 GGAGGGGGATGTAGAGGGATGGG + Intronic
1032592040 7:133200506-133200528 GGGGTGGGAGGAGTAGGTGTGGG - Intergenic
1032900143 7:136297814-136297836 GGAGTGGGTTGAAGAGGGGTAGG + Intergenic
1033085096 7:138334002-138334024 GGGGTGGCATGGAGAGATACAGG - Intergenic
1033464503 7:141578551-141578573 GGGGTGGCATGGAGAGATAATGG + Intronic
1034084309 7:148309900-148309922 GGGGTGGTATGGAGAGATAATGG + Intronic
1035059180 7:156056568-156056590 TAGATGGGATGAAGAGGTGTGGG + Intergenic
1036070471 8:5436943-5436965 GGGGTGGTATGGAGAGATAATGG + Intergenic
1036442078 8:8790219-8790241 GTGTTGGGATGAAGAGATTTTGG - Intronic
1036550182 8:9808843-9808865 GGGGTGGTATGGAGAGATAATGG - Intergenic
1036912823 8:12772100-12772122 GGGGTGGGATGGGGAGATGTAGG - Intergenic
1037321872 8:17651204-17651226 GGGGTGGGATGAGGAGAGGTTGG + Intronic
1037369627 8:18162304-18162326 GGGGTGGGGTAGAGTGGTATAGG - Intergenic
1038043960 8:23750498-23750520 GGAGAGGGAGGAAGAGGGATAGG - Intergenic
1038927705 8:32158693-32158715 GGGGAGGGAAGCAGAGGTAGGGG - Intronic
1039575329 8:38619139-38619161 GGGGTGGGATGAGATGGGATGGG - Intergenic
1040648568 8:49425868-49425890 GGGGTGGTATGGAGAGATAATGG - Intergenic
1040860935 8:51998850-51998872 GGTGTGGGATGCAGAGGCCTTGG + Intergenic
1042150796 8:65781342-65781364 GGGGTGGGGTGGAGAGGCAGTGG + Intronic
1042430844 8:68704653-68704675 TGGGTGGAATGAAGAGTTGTGGG - Intronic
1042453956 8:68978218-68978240 GGGGTGGTATGGAGAGGGAATGG - Intergenic
1043040489 8:75256219-75256241 GGGGAGGTATGAAGAGAGATTGG + Intergenic
1043426921 8:80156895-80156917 GGGGTGGGGTGGAGAAGAATGGG + Intronic
1043667176 8:82829498-82829520 GGAGTGGGAAGAGGAGGAATGGG - Intergenic
1044876751 8:96676238-96676260 TGGGAGGGATGAAGAGAGATTGG - Intronic
1045533286 8:103004104-103004126 GGGGTGGTATGGAGAGATAATGG - Intergenic
1046075474 8:109306937-109306959 GGGGTGGTATGGAGAGATAATGG - Intronic
1046383809 8:113483778-113483800 GGGGTGGGAGGAAGTGGTAATGG - Intergenic
1048098006 8:131315402-131315424 GGGGTGGTATGGAGAGATAATGG - Intergenic
1049494606 8:142923905-142923927 TGGGTGGGCTGAGGAGGGATGGG - Intergenic
1049509330 8:143019524-143019546 GGGGTGGGGGGAAAAGGAATTGG + Intronic
1051073141 9:13197733-13197755 GGGGTGGGATGAAGAGGTATTGG - Intronic
1051309372 9:15753142-15753164 AGGGTGAGATGAAGAGATACAGG + Intronic
1051952978 9:22658999-22659021 GGGGTGGTATGGAGAGTTAATGG + Intergenic
1052192311 9:25674669-25674691 GGGGTGGTATGGAGAGATAATGG - Intergenic
1053058466 9:35008877-35008899 GGGGTGGTATGGAGAGATAATGG - Intergenic
1053311844 9:37025433-37025455 GGGGTGGGAGGACCAGGCATGGG + Intronic
1053389355 9:37723161-37723183 GGGGTGGGATGGAGAGGGTAGGG - Intronic
1054114586 9:61149095-61149117 GGGGTGGAATGGATAGATATTGG - Intergenic
1054593168 9:67033432-67033454 GGGGTGGAATGGATAGATATTGG + Intergenic
1055195759 9:73591580-73591602 AGTGTTGGAGGAAGAGGTATGGG - Intergenic
1056278188 9:85013717-85013739 AGGGTGTGATGAGGAGGTCTAGG + Intronic
1056798979 9:89678236-89678258 GGGGTGGGAGGCAGAGGGCTAGG + Intergenic
1057429472 9:94980503-94980525 GGAGGGGGATGAAAAGGTAATGG - Intronic
1057806700 9:98224755-98224777 GGGGTCAGATGAAGGGGCATGGG + Intronic
1058612839 9:106793757-106793779 GGGGTGGTATGGAGAGATAATGG - Intergenic
1058870171 9:109194476-109194498 GGGGTGGGAAGACCAGGGATGGG + Intronic
1058891877 9:109368320-109368342 GGGCTGGAAGGAAGAGGAATGGG - Intergenic
1059400768 9:114069655-114069677 GGGGTGGGATGGGGTGGGATGGG + Intronic
1059545761 9:115175136-115175158 GGGGTGGTATGGAGAGATAATGG + Intronic
1059954082 9:119497991-119498013 AGGGGGGGATGAAGAAGTGTTGG - Intronic
1060032334 9:120225827-120225849 GGGGTGAGATGAATGGGTAGAGG - Intergenic
1060318020 9:122531080-122531102 GGGGTGGTATGGAGAGATAATGG + Intergenic
1060334487 9:122709074-122709096 TGTGTGGGAGCAAGAGGTATGGG + Intergenic
1060602576 9:124888042-124888064 GGGGTGGGGAGAAGAGGGCTGGG + Intronic
1060753981 9:126196747-126196769 GGGGAGAGAGGAAGAGGGATAGG - Intergenic
1060886167 9:127154052-127154074 GGGGTGGGATGGGAAGGTAGGGG - Intronic
1061520519 9:131114828-131114850 GGGGTGGGAGGCTGAGGTGTGGG - Intronic
1061561666 9:131408095-131408117 GGGGTGGGAAGAAGAGGATGGGG + Intronic
1061578460 9:131522461-131522483 GGGAGGGGATGAAGAGATGTGGG + Intronic
1061583379 9:131551432-131551454 GGGGTGGTATGGAGAGATAATGG - Intergenic
1061750959 9:132776736-132776758 GGGGTGGGATGAGAAGGCACTGG - Intronic
1062035863 9:134382244-134382266 GGGGAGGAAGGAAGAGGTTTGGG + Intronic
1062243766 9:135553001-135553023 GGAGTGGGAGGCAGAGGCATGGG - Intergenic
1185915552 X:4030709-4030731 AGGGTTGGAGGAAGAGGGATAGG - Intergenic
1185945675 X:4373351-4373373 GGGGTGGGAAAAATAGGTGTTGG + Intergenic
1185960271 X:4540989-4541011 GGGGTGGTATGGAGAGATAATGG + Intergenic
1186501674 X:10055688-10055710 GGGGTGGGATGAAGAGACAGTGG + Intronic
1186657176 X:11625545-11625567 GGGGAGGAATGAAGAGGGCTCGG + Intronic
1186747802 X:12587434-12587456 GGGGTGGGGAGAAGGGGGATGGG - Intronic
1186853330 X:13601812-13601834 GGGGTGGGAGGAGGAGGTTCTGG - Intronic
1187086109 X:16045196-16045218 GGGGTGGTATGGAGAGATAATGG + Intergenic
1187099565 X:16179685-16179707 GGGGTGGTATGGAGAGATAATGG + Intergenic
1187103345 X:16217328-16217350 GGGGTGGTATGGAGAGATAACGG + Intergenic
1187233678 X:17446207-17446229 GGGGTGGTATGGAGAGATAATGG - Intronic
1188439472 X:30201189-30201211 GGGGAGGGATGAATAGGCAGAGG + Intergenic
1188502805 X:30847346-30847368 GGGCTGGCCTGAAGAGGTAGAGG - Intronic
1189067239 X:37823411-37823433 GGGATGGGAAGAAGGGGTAGGGG + Intronic
1189136059 X:38551572-38551594 GGGGTGGTATGGAGAGATAATGG - Intronic
1191006238 X:55714172-55714194 GGGGAGGGATGAAGAAGAAAAGG - Intergenic
1191013776 X:55788822-55788844 GGGGTGGTATGGAGAGATAATGG + Intergenic
1191852298 X:65594420-65594442 GTGGTGGGATGAAGTGGTGGGGG + Intronic
1191975981 X:66871959-66871981 GGGGTGTGATAAAGAGATGTTGG - Intergenic
1192052535 X:67739095-67739117 GGGGTGGGATATGGAGGGATTGG - Intergenic
1192149559 X:68703697-68703719 GGGGTGGGATGCAGACGTGGTGG + Intronic
1192455475 X:71272195-71272217 GGGGTGGTATGGAGAGATAATGG - Intergenic
1192469205 X:71382336-71382358 GGGATGGGATGAAAAGATACAGG + Intronic
1192706652 X:73533453-73533475 GGGGTGGTATGGAGAGATAATGG - Intergenic
1192730922 X:73801897-73801919 GGGGTGGTATGGAGAGTTACTGG + Intergenic
1193107332 X:77691229-77691251 GGGGTGGGAAGAAGGGGAAATGG + Intronic
1193537562 X:82732422-82732444 GGGGTGGTATGGAGAGATAATGG - Intergenic
1194367521 X:93028130-93028152 GGGGTGGTATGGAGAGATAATGG - Intergenic
1194661210 X:96629996-96630018 GGGGTGGTATGGAGAGATAATGG - Intergenic
1195491218 X:105472061-105472083 GGGGTGGGATGGAGGGGTGGTGG + Intronic
1195842404 X:109188557-109188579 GGGTGGGGATGCAGAGGTGTAGG + Intergenic
1196051208 X:111306992-111307014 GGGGTTGGATGAAAAGGGAAGGG + Intronic
1196226711 X:113176672-113176694 GGGGTGGTATGGAGAGATAATGG + Intergenic
1196524965 X:116720798-116720820 GGGGTGGTATGAAGAGATAATGG + Intergenic
1197793706 X:130279732-130279754 GGGGTGGTATGGAGAGATAATGG - Intergenic
1198598858 X:138264006-138264028 GGGGTGGTATGGAGAGATAATGG - Intergenic
1198598990 X:138264829-138264851 GGGGTGGTATGGAGAGATAATGG + Intergenic
1198890926 X:141395417-141395439 GGGGTGGTATGGAGAGATAATGG + Intergenic
1198966462 X:142232531-142232553 GGGGTGGTATGGAGAGATAATGG - Intergenic
1198983296 X:142423860-142423882 GGGGTGGTATGGAGAGATAATGG + Intergenic
1199073247 X:143502660-143502682 GGGGTGGTATGGAGAGATAATGG + Intergenic
1199377573 X:147132149-147132171 GGGGTGGTATGGAGAGATAATGG + Intergenic
1199818395 X:151420726-151420748 GGGGTGGAAGGAAGAGCCATGGG + Intergenic
1199921563 X:152410232-152410254 GGGGAAGGATAAAGAGGTAATGG + Intronic
1200007204 X:153095068-153095090 GGGGTGGTATGGAGAGATAATGG + Intergenic
1200675729 Y:6144389-6144411 GGGGTGGTATGGAGAGATAATGG - Intergenic
1201113094 Y:10814867-10814889 GGAGTGGAATGAAGTGGAATGGG - Intergenic
1201137448 Y:11000671-11000693 GGAGTGGAATGGAGAGGAATGGG - Intergenic
1201233533 Y:11888922-11888944 GGGGTGGTATGGAGAGATAATGG + Intergenic
1201438560 Y:13985379-13985401 GGGGAGGGAGGAAGAGGTGGTGG - Intergenic
1201446013 Y:14057329-14057351 GGGGAGGGAGGAAGAGGTGGTGG + Intergenic