ID: 1051073142

View in Genome Browser
Species Human (GRCh38)
Location 9:13197739-13197761
Sequence TGAGGAGGGGTGGGATGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1345
Summary {0: 1, 1: 1, 2: 8, 3: 108, 4: 1227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051073142_1051073149 -4 Left 1051073142 9:13197739-13197761 CCTCTTCATCCCACCCCTCCTCA 0: 1
1: 1
2: 8
3: 108
4: 1227
Right 1051073149 9:13197758-13197780 CTCAAACTCTTCCAAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051073142 Original CRISPR TGAGGAGGGGTGGGATGAAG AGG (reversed) Intronic
900090717 1:919285-919307 TGGGGAGGGGTGGGGTGCCGTGG - Intergenic
900166033 1:1244744-1244766 TGAGGAGTGGGGGGAGGAGGGGG - Intronic
900166102 1:1244927-1244949 TGGGGAGGAGTGGGGGGAAGAGG - Intronic
900166140 1:1245029-1245051 TGAGGAGTGGGGGGAGGAGGGGG - Intronic
900166172 1:1245096-1245118 TGAGGAGTGGGGGGAAGGAGTGG - Intronic
900377436 1:2362319-2362341 TGAGGAGGAGGAGGAAGAAGAGG + Intronic
900378989 1:2374339-2374361 TGGGGAGGGGTGGGGCAAAGTGG - Intronic
900479172 1:2889913-2889935 TGGGGGGAGGTGGGATGAGGTGG + Intergenic
900483595 1:2910958-2910980 TGAGGGGTGGTGGGGTGCAGTGG + Intergenic
900588089 1:3443249-3443271 GCAGGACGGGAGGGATGAAGAGG - Intergenic
900588097 1:3443286-3443308 GCAGGACGGGAGGGATGAAGAGG - Intergenic
900588105 1:3443323-3443345 GCAGGACGGGAGGGATGAAGAGG - Intergenic
900624715 1:3602972-3602994 TGGGGAGGGCTGGGGTGGAGAGG - Intronic
900658918 1:3773197-3773219 TGAGGCGCTGTGGGGTGAAGAGG + Intronic
900810359 1:4797154-4797176 AGAGGCAGGGTGGGATGGAGAGG + Intergenic
901457026 1:9368819-9368841 TGAGAGGGGTTGGGATGAACTGG - Exonic
901548672 1:9978714-9978736 TCAGAAGGGTTGGGATGTAGGGG + Intronic
901657550 1:10778913-10778935 TGATGGGAGGTGGGATGTAGGGG - Intronic
902376775 1:16033568-16033590 GGAGGTGGGGGGGGATGTAGAGG - Intronic
902524619 1:17048125-17048147 GGAGGTAGGGTGGGAGGAAGTGG - Intronic
902649373 1:17826607-17826629 TGAGGTGGGGTGGGGTGAGCTGG + Exonic
902687938 1:18091052-18091074 TGAGAAGGGATGGGGAGAAGGGG + Intergenic
902737930 1:18413593-18413615 TGGGGAGGGGTGGGAGGGAAAGG - Intergenic
903073814 1:20745745-20745767 TTGGGAAGGGTGGGAAGAAGTGG - Intronic
903128170 1:21261761-21261783 TTCGGAGGGGTGGGGAGAAGAGG + Intronic
903296504 1:22346712-22346734 AGAGGAGGGGGAGGAAGAAGAGG - Intergenic
903969960 1:27112246-27112268 TGAGGAGGCGTGGGAGGAACAGG + Intronic
904044812 1:27602977-27602999 TGGGGGGGGGGGGAATGAAGGGG - Intronic
904587146 1:31586809-31586831 TAAGGAGGGGTGGTGAGAAGGGG - Intronic
904595908 1:31645117-31645139 TGAGGTGGAGTGGGCCGAAGAGG + Intergenic
904614675 1:31743330-31743352 TGGGGAGGGGTGGAATGGCGTGG - Intronic
904678478 1:32212811-32212833 CAATGAGGGGTGGGAAGAAGGGG + Intronic
904686799 1:32266641-32266663 TGAGGAGGGGGAGGAGGAAGAGG - Intronic
904831180 1:33307595-33307617 TTGGGAGGGGTGGGATGAGGTGG - Intronic
905010974 1:34746918-34746940 TGCGGAGGGGCGGGACGCAGAGG + Intronic
905295683 1:36953036-36953058 TGAGGAGGAGCGGGAGGAGGAGG + Intronic
905309283 1:37038164-37038186 TGGGGAGGGGTGGGGGGACGAGG - Intergenic
905456465 1:38091567-38091589 TGAGGAGAGGAGGGGTGCAGTGG + Intergenic
905863724 1:41365986-41366008 TGATGAGAGGTGGGATCAGGAGG + Intronic
906145481 1:43557973-43557995 AGGGGAGGGGTGGGGTGAGGCGG - Intronic
906264265 1:44416985-44417007 TGGGGAGGGCTGGGGTGAGGGGG + Intronic
906274740 1:44507450-44507472 TGATTGGGGGTGGGGTGAAGGGG + Intronic
906439473 1:45828580-45828602 TGAAGAATGGTGGGAAGAAGGGG + Intronic
906520617 1:46464890-46464912 TCAAGAGAGGTGGGATGAGGGGG + Intergenic
906963273 1:50432367-50432389 TGAGAAGAGATGGGGTGAAGGGG - Intergenic
906996168 1:50796619-50796641 TGAGAAGGGTAGGGATGTAGAGG - Intronic
907499459 1:54867650-54867672 TGAGGAGGGATGGGACCAAGGGG - Intronic
907998333 1:59655423-59655445 TGTGGTGGGGTGGGGTGGAGGGG - Intronic
908201504 1:61800725-61800747 TGTTGTGGGGTGGGAAGAAGGGG - Intronic
908982754 1:69978291-69978313 AGAGGAGGGGAGGGAAGAGGAGG + Intronic
909590706 1:77346138-77346160 TGAGGAGGAGGAGGAAGAAGAGG + Intronic
910068133 1:83178353-83178375 TGAGGAGGGGAAGGAAGATGGGG + Intergenic
910237537 1:85050199-85050221 AGAGGAGGGGTGGTACGGAGAGG + Intronic
910428293 1:87137429-87137451 TGAATGGTGGTGGGATGAAGAGG + Intronic
910441803 1:87260669-87260691 TGAGGAGAGTAGGGATGGAGAGG + Intergenic
910811519 1:91242261-91242283 TGTGGTGGGGTGGGGGGAAGGGG + Intergenic
911418490 1:97607685-97607707 GGAGGAGGGGTAGGAAAAAGCGG + Intronic
911903632 1:103537369-103537391 TGAGGAGATGTGGGTGGAAGAGG - Exonic
912203023 1:107480066-107480088 TGAGGAGGGGTGGGGACACGGGG - Intronic
912407298 1:109451232-109451254 TGGGGAAGGGAGGGATGAATAGG + Intergenic
912448720 1:109757108-109757130 TGAGGAGGGGTGAGATCACTTGG + Exonic
912458573 1:109816359-109816381 TGAGGAGGGGTGTGTGGATGTGG + Intergenic
912710124 1:111944146-111944168 TGAGAAGGGGTGGATTGCAGGGG + Intronic
913193020 1:116429674-116429696 AGAGGAAGGGAGGCATGAAGTGG - Intergenic
913205230 1:116532611-116532633 TGGGGTGGGGTGGGATGGGGTGG - Intronic
913329897 1:117658692-117658714 TGAGGGGGTGTGGGATGCAGAGG + Intergenic
913591651 1:120334471-120334493 TGACATGGGATGGGATGAAGAGG + Intergenic
913651709 1:120920678-120920700 TGACATGGGATGGGATGAAGAGG - Intergenic
914169396 1:145208387-145208409 TGACATGGGATGGGATGAAGAGG + Intergenic
914524513 1:148452351-148452373 TGACATGGGATGGGATGAAGAGG + Intergenic
914599155 1:149183479-149183501 TGACATGGGATGGGATGAAGAGG - Intergenic
914641890 1:149614789-149614811 TGACATGGGATGGGATGAAGAGG - Intergenic
914868510 1:151453263-151453285 TGAGGTGGGGTAGGAGGGAGTGG + Intronic
914960082 1:152197397-152197419 GGAGGAGGGGGAGGAGGAAGAGG - Intergenic
915204574 1:154260580-154260602 AGAAGAGGGGAGGGAAGAAGAGG + Intronic
916075365 1:161197376-161197398 GGAGGAGGGAAGGGAAGAAGGGG + Intronic
916119124 1:161512269-161512291 TGTGGAGGGATGGGGTGGAGTGG + Intronic
916128883 1:161593928-161593950 TGTGGAGGGATGGGGTGGAGTGG + Intronic
916138799 1:161675759-161675781 TGTGGAGGGATGGGGTGGAGTGG + Intronic
916152652 1:161810518-161810540 TGAGGTGAGGTGGGGTAAAGGGG - Intronic
916215922 1:162394641-162394663 TGGGGTGGGGTGGGGTGGAGTGG - Intergenic
916332103 1:163628398-163628420 AGAGGAGGGGTGGGAGGAGAAGG - Intergenic
917598568 1:176553381-176553403 TGTTGAGGGGTGGGATGGAAAGG + Intronic
917672798 1:177289026-177289048 AGGGGAGGGGTGGGAAGAAAAGG + Intergenic
917865513 1:179190597-179190619 GGGGGTGGGGTGGGATGGAGGGG + Intronic
918066996 1:181108120-181108142 GGAGCAGGTGTGGGATGCAGAGG + Intergenic
918263306 1:182816877-182816899 TGGGGTAGGGTGGGATGGAGTGG - Intronic
918406208 1:184214034-184214056 TGAGGAGGGGAGGGGGGCAGGGG - Intergenic
918672276 1:187233540-187233562 TGAGGAAGTGGGGGAAGAAGTGG - Intergenic
919661405 1:200251538-200251560 TGAGGAGGGGTGGGTGGTGGTGG - Intergenic
919817524 1:201450990-201451012 TGGGAAGGGGTGGGGTGAGGGGG - Intergenic
919915150 1:202134366-202134388 TGAGGAGGGGTGGGCTTAGGGGG + Exonic
920639327 1:207736327-207736349 TGTGGTGGGGTGGGGGGAAGGGG + Intronic
920656755 1:207882290-207882312 AGAGGTGGGATGGGGTGAAGGGG - Intergenic
921184187 1:212655942-212655964 TGAGGAGAGGTGGGATGGGTGGG + Intergenic
921221484 1:212977024-212977046 TGAGGAGGGGTGGGTTTCAAGGG + Intronic
921276717 1:213528015-213528037 TGAGGAGGAGGAGGAAGAAGAGG + Intergenic
921606342 1:217160005-217160027 TGGGGAGAGGAGGGATGAATAGG + Intergenic
921878785 1:220230073-220230095 TGAGGAGGGGAGGGAAGGAAAGG - Intronic
922006935 1:221540830-221540852 TGTGCATGGGTGGGATGAGGTGG + Intergenic
922468468 1:225861070-225861092 TGAGTAGGAGTGGGAGGCAGTGG + Intronic
922574884 1:226654933-226654955 TGAAGAGGGGGAGGAGGAAGAGG + Intronic
922721052 1:227900531-227900553 TGTGGAGGGATGGGATGTGGAGG - Intergenic
922740403 1:228011100-228011122 GGAAGAGGGGTCGGGTGAAGAGG + Intronic
922854655 1:228764260-228764282 TGAGGAGGAGGAGGAAGAAGAGG + Intergenic
923054140 1:230412729-230412751 TGAGGAGGAGGAGGAGGAAGAGG + Intronic
923355135 1:233147459-233147481 TGAGGAGGAGAAGGAGGAAGAGG + Intronic
923714810 1:236415825-236415847 AGATGAGGGGTGGGATGGGGTGG + Intronic
923769684 1:236927593-236927615 TGAGGAGGAGGAGGAGGAAGAGG + Intergenic
923903465 1:238355578-238355600 TGAGGAGGAGGAGGAAGAAGAGG - Intergenic
924424826 1:243941369-243941391 TGGAGAGGGAGGGGATGAAGTGG + Intergenic
924516462 1:244770191-244770213 AGAGGAAGGGAGGGATGCAGAGG + Intergenic
924544594 1:245014659-245014681 TGAGGTGGGGTGGGGTGTGGGGG + Intronic
924548391 1:245051497-245051519 TGAGGAGGGAAGGGAGGGAGTGG + Intronic
924715221 1:246566670-246566692 AGAGGAGGAGCGGGATGCAGGGG + Intronic
924732071 1:246721263-246721285 TGTTGTGGGGTGGGAGGAAGGGG + Intergenic
924758273 1:246961863-246961885 TGATGAAGGGAGTGATGAAGAGG - Intronic
1062818165 10:516345-516367 AGAGGAGGGGGGGGATGGGGAGG + Intronic
1062819273 10:522080-522102 TGGGGAGGGGAGGGGTGAATGGG - Intronic
1062912567 10:1221563-1221585 TGTGGTGGGGTGGGGTGAGGGGG - Intronic
1062999468 10:1901484-1901506 TGAGGAAGGGAGGGAGGAACAGG - Intergenic
1063643122 10:7851394-7851416 TTAGGAGAGGAGGGATCAAGAGG + Intronic
1063919746 10:10920842-10920864 TTAGGAAGGGAGGGAGGAAGGGG + Intergenic
1064029447 10:11874626-11874648 GGAGGAGGGGGAGGAGGAAGGGG + Intergenic
1064105070 10:12493820-12493842 TTATGTGGGGTGGGATCAAGTGG + Intronic
1064412250 10:15116320-15116342 TAAGTAGGGGTGGGCTAAAGAGG + Intronic
1064621870 10:17225553-17225575 CTAGCAGGGGTGGGAAGAAGGGG - Intergenic
1064663883 10:17630803-17630825 GGACCAGGTGTGGGATGAAGGGG + Intergenic
1065024085 10:21525509-21525531 TGAGGCGGGGTGGGGTGGAGCGG - Intronic
1065058512 10:21872723-21872745 TGGGGAGGAGTGGGAGAAAGAGG + Intronic
1065446304 10:25805117-25805139 TGAGGAGGAGGAGGAGGAAGAGG - Intergenic
1065637101 10:27743933-27743955 TCAGGAGGGGTTGGATGGAAGGG + Intronic
1065653271 10:27916567-27916589 TGAGGAGGAGGAGGAAGAAGAGG - Intronic
1066395937 10:35021856-35021878 TGAGGTGGGGTGGGGTGAGGTGG + Intronic
1066450050 10:35520842-35520864 TGGGGAGGGGTTGGCTGCAGAGG - Intronic
1066782019 10:38961219-38961241 TGAGGAGGGGATGGATGCATAGG + Intergenic
1066932162 10:41776296-41776318 TGACGTGGGGTGGGAGGAGGGGG + Intergenic
1067051296 10:43022865-43022887 TGAGAAGGGGTGGAGAGAAGTGG + Intergenic
1067400711 10:45971300-45971322 TGAGTAGGAGTTAGATGAAGAGG - Intergenic
1067471354 10:46541038-46541060 TCACGAGGGGCTGGATGAAGAGG - Intergenic
1067758836 10:49027574-49027596 TGCAGAGGGGTGGCATGCAGGGG - Intronic
1067869055 10:49940857-49940879 TGAGTAGGAGTTAGATGAAGAGG - Intronic
1067877058 10:50016586-50016608 TGAGGAGGGGGAGGAGGAGGAGG - Intergenic
1068152450 10:53150823-53150845 GGAGGAGGGGAGGGAGGAGGAGG - Intergenic
1069127907 10:64660492-64660514 TGTGGTGGGGTGGGGGGAAGGGG + Intergenic
1069449067 10:68501566-68501588 AGAGGAGGGGAGGGAAGAGGAGG + Intronic
1069965232 10:72109799-72109821 TGAGTAGGGGTAGGAGGTAGAGG + Intronic
1070291956 10:75123157-75123179 TGGGGTGGGGTGGGGTGAGGTGG - Intronic
1070326118 10:75390384-75390406 AGAGGAGGAGGGGGAGGAAGAGG - Intergenic
1070810046 10:79293125-79293147 TGGGGTGGGGTGGGGTGAGGTGG - Intronic
1070817880 10:79336513-79336535 TGGGGAGGTGTGGGGGGAAGAGG + Intergenic
1071275228 10:84048273-84048295 TGAGGCAGGGTGTCATGAAGGGG - Intergenic
1071528645 10:86373025-86373047 TGAGGAGGGGTGTGGTGGGGTGG - Intergenic
1071712380 10:88062332-88062354 TGAGGAGGTGGGGGATGGGGAGG - Intergenic
1072034895 10:91554734-91554756 TGATGTGGTGTGGGATGAGGTGG - Intergenic
1072253681 10:93601101-93601123 TGGGGTGGGGTGGGGTGAGGTGG - Intronic
1072612406 10:97027012-97027034 GGAGGAGGGGTGTGTGGAAGAGG - Intronic
1072740490 10:97906169-97906191 GGGGGAGGTGTGGGAAGAAGAGG + Intronic
1072997934 10:100263014-100263036 TGAGGTGGGGTGGAGTGGAGTGG - Intronic
1073173539 10:101534455-101534477 TGTGGAGGGCAAGGATGAAGTGG - Intronic
1073207234 10:101775716-101775738 TGAGGAGGGGTGCGCGGAGGCGG - Intronic
1073208681 10:101781810-101781832 TGAGGAGGAGAGCGAGGAAGAGG - Exonic
1073443721 10:103568397-103568419 GCAGGATGGGTGGGAAGAAGAGG + Intronic
1073582752 10:104682806-104682828 GGAGGAAGGTTGGGATGGAGGGG + Intronic
1073592197 10:104767812-104767834 GGAGGAGAGGGGGGAAGAAGAGG - Intronic
1073597704 10:104817370-104817392 GGAGGAGGAGGGGGAGGAAGGGG - Intronic
1073838153 10:107467854-107467876 TGTGGTGGGGTGGGGGGAAGGGG + Intergenic
1074086294 10:110210625-110210647 GGAGAGGGGGTGGGATAAAGTGG - Intronic
1074143389 10:110696558-110696580 TGATGAAGGTGGGGATGAAGTGG + Intronic
1074382509 10:112992158-112992180 TGAGGAGGGGTGGGGGGCAGAGG + Intronic
1074403893 10:113164516-113164538 TGAGGATGGGATGGATGGAGGGG - Intronic
1074406054 10:113181123-113181145 TGAGGAGGGGGAGGCTGGAGTGG - Intergenic
1074413254 10:113245637-113245659 TGAGGAGGGGTGAGGGGTAGTGG + Intergenic
1074639292 10:115362666-115362688 TGTGGTGGGGTGGGAGGAGGTGG - Intronic
1074699242 10:116078929-116078951 TTAGGAGGGGTGGGATTGAATGG - Intronic
1074861190 10:117511867-117511889 AGAGAAGCGGTGGGTTGAAGGGG + Intergenic
1074878220 10:117631289-117631311 CTAGGAGGAGTGGGGTGAAGGGG - Intergenic
1075154187 10:119960483-119960505 TAAGGAGGGGAGGGGTGAGGAGG + Intergenic
1075291782 10:121237022-121237044 TCAGGAGGGGTGGGTAGAAGGGG + Intergenic
1075491351 10:122872781-122872803 TGTGGTGGGGTGGGAGGAGGGGG + Intronic
1075840141 10:125494417-125494439 TGAGGTGGGGTGGGGTGGTGGGG - Intergenic
1076019249 10:127056962-127056984 GGAGCAGGGGTGGGATGGGGAGG - Intronic
1076053345 10:127352231-127352253 TGGGGAGGGGTGGGGAGAAGTGG + Intronic
1076053362 10:127352271-127352293 TGGGGAGGGGTGGGAAGCATCGG + Intronic
1076286132 10:129298235-129298257 TGAGGAGGGGGAGGAGGAGGAGG + Intergenic
1076495180 10:130892609-130892631 TGTGGAGGAGAGGGAGGAAGAGG - Intergenic
1076517897 10:131059530-131059552 TGAGGAGGGGTGGGAATGAGCGG + Intergenic
1076543303 10:131227963-131227985 TGAGGAGGGGTGGGGTGAGGAGG - Intronic
1076591550 10:131587107-131587129 AGAGGAGGGGTTGGCTGATGGGG + Intergenic
1076645896 10:131953973-131953995 TGTTGAGGGATGCGATGAAGGGG + Intronic
1076693294 10:132234644-132234666 TGGGGAGTGGTGGGATGCCGGGG + Intronic
1076729411 10:132431046-132431068 TGAGCAGGGGTGGGGTGCGGGGG - Intergenic
1076786562 10:132752577-132752599 TGAGGAGGTGTGGCATGGAGGGG + Intronic
1076921443 10:133456591-133456613 GGAGGAGGAGTGGGAGGACGAGG + Intergenic
1077107570 11:848682-848704 TGAGGAAGGGCAGGAGGAAGAGG - Intronic
1077130813 11:971527-971549 CGAGGATGGCTGGGAAGAAGTGG + Intronic
1077235976 11:1482158-1482180 TTTGGAGGGGTGGGTTGCAGTGG + Intronic
1077309420 11:1881825-1881847 ACAGGAGGGGAGGGAGGAAGAGG + Intronic
1077708764 11:4515022-4515044 TGAGGATAGGTGGGATGAGGAGG + Intergenic
1077783201 11:5354618-5354640 CGTGGAGGGGCGGGAGGAAGTGG - Intronic
1077957148 11:7032955-7032977 TGAGGTGGAGGGGGATGAAGGGG - Intronic
1078422620 11:11224647-11224669 TTAGCAGGGGTGGCATGGAGAGG + Intergenic
1078508073 11:11966665-11966687 TAAGGAGTGGTGGGAGGGAGGGG + Intronic
1078785393 11:14486022-14486044 TGAGGAGGAGGAGGAGGAAGAGG + Intronic
1079237326 11:18699773-18699795 TGAGGAGGATTGGGAAGAGGCGG - Intronic
1079249161 11:18774512-18774534 TGAGGAGGAGGGGGCTGGAGGGG + Intronic
1079619632 11:22537557-22537579 TGTCGTGGGGTGGGATGATGGGG + Intergenic
1080120237 11:28668323-28668345 TGAAGATGGTTGGGTTGAAGAGG + Intergenic
1080123529 11:28704624-28704646 TGAGGAAGGGTGGTAGGAAATGG + Intergenic
1080403017 11:31954661-31954683 TGAGGAGGGGTGATATGATTTGG + Intronic
1080404690 11:31968274-31968296 TGGGGAGGGTGGTGATGAAGGGG + Intronic
1080585285 11:33676241-33676263 TGAGGAGCTGAGTGATGAAGTGG - Intergenic
1080683493 11:34496649-34496671 TCTGGAGGGGAGGGATGAGGAGG - Intronic
1080908553 11:36572035-36572057 TGAGCAGGGGTGGGATTAGGAGG - Intronic
1081371938 11:42314771-42314793 TGAGGAGGAGGGGAAAGAAGGGG + Intergenic
1081423256 11:42897421-42897443 TGTGGTGGGGTGGGAGGAGGGGG - Intergenic
1081464727 11:43305842-43305864 TGAGGAAGGGAGAGTTGAAGAGG + Intergenic
1081530719 11:43957302-43957324 TGGGGTGGGGTGGGAGGAGGGGG + Intergenic
1081615356 11:44587572-44587594 AGAGGAGTGGTGGGTTGGAGGGG + Intronic
1081723668 11:45309671-45309693 TGTCGTGGGGTGGGGTGAAGGGG - Intergenic
1081739782 11:45430722-45430744 AGGGGAGGGGAGGGATGATGTGG + Intergenic
1081882140 11:46462703-46462725 TGGGGAGATGAGGGATGAAGGGG - Intronic
1082728072 11:56760615-56760637 TGTGGTGGGGTGGGAGGAGGGGG + Intergenic
1082800848 11:57413879-57413901 TAAGGAGGGAGGAGATGAAGAGG - Intronic
1083162709 11:60865094-60865116 TGAGCAGAGGTGGGAGGAGGCGG - Intergenic
1083619096 11:64040253-64040275 TGCTGAGGGGTGGGATTGAGGGG + Intronic
1083622588 11:64056433-64056455 GGAGGAGGGTGGGGAGGAAGGGG + Intronic
1083776259 11:64895589-64895611 GGAGGAAGAGTGGGAGGAAGTGG - Intronic
1083782625 11:64925991-64926013 TGGGGAGGGGTGGGAGGCAGCGG + Intronic
1083990523 11:66243451-66243473 TGTGCAGGGGTGGGCTGGAGGGG - Exonic
1084209878 11:67615987-67616009 TGAGTAGGGGCGGGAAGAGGGGG - Intergenic
1084518925 11:69651080-69651102 TGGGGAGAGGTGGGAAGAGGGGG - Intronic
1084949726 11:72657966-72657988 TGAGGAGGGGTGGAGGGAAGAGG + Intronic
1084976030 11:72798877-72798899 AGAGGTGGATTGGGATGAAGTGG - Intergenic
1085036814 11:73305875-73305897 TGTGGAGGGGTGGGTTGTGGAGG - Intergenic
1085463703 11:76710308-76710330 GGTGGAGGAGTGGGAAGAAGGGG - Intergenic
1085689648 11:78654803-78654825 TGTGGGGGGGTGGGATAAAAAGG + Exonic
1085822239 11:79805309-79805331 TGAGTAGGGGTTGGATGATGAGG + Intergenic
1086488830 11:87337978-87338000 AGGGGAGGGGAGGGAAGAAGAGG + Intergenic
1086807106 11:91257370-91257392 TGATGTGGGGTGGGAGGAGGGGG + Intergenic
1087025296 11:93643641-93643663 GGAGCAAGGGTGGGATCAAGTGG - Intergenic
1087594760 11:100238540-100238562 GGAGGAGGAGGGGGAAGAAGAGG + Intronic
1088298133 11:108323404-108323426 TGTGGAGGGAGAGGATGAAGAGG + Intronic
1088372916 11:109111045-109111067 GGGGGTGGGGTGGGATGAGGGGG - Intergenic
1088981733 11:114870664-114870686 AGAGGTGGGGAGGGAAGAAGAGG + Intergenic
1089008010 11:115108702-115108724 GGAGCAGGGGTGGAATGACGTGG - Intergenic
1089196373 11:116696099-116696121 TAAGGAGGGAGGGGAGGAAGAGG - Intergenic
1089329208 11:117678166-117678188 GGAGGAGGGATGAGAGGAAGAGG - Intronic
1089447532 11:118565488-118565510 TGGGGTGGGGTGGGCTGAGGCGG + Intronic
1089486715 11:118852205-118852227 GGAGGAGGGGTGGGTAGAGGAGG + Intergenic
1090085430 11:123646102-123646124 TGAGTGGTGGTGGAATGAAGGGG - Intronic
1090172461 11:124616942-124616964 AGAGGAGAGGTGGGAAGGAGAGG - Intronic
1090482539 11:127080868-127080890 TGGGGTGGGGTGGGGTGGAGTGG + Intergenic
1091141346 11:133237674-133237696 TGAAGAGAGGAAGGATGAAGGGG - Intronic
1091433964 12:459770-459792 TGGGAACGGGTGGGATGAGGAGG - Intergenic
1091603139 12:1929955-1929977 GGAGGAAGAGTGGGATGAAGAGG + Intergenic
1091607936 12:1972825-1972847 TGAGGAAGGGAGGGAGGGAGAGG + Intronic
1092022605 12:5214821-5214843 TGTGTAGGTGTGGGAGGAAGGGG - Intergenic
1092275807 12:7060249-7060271 TGTGGAGGGATGTTATGAAGAGG + Intronic
1093079293 12:14790714-14790736 TGAGGAGGGACGGGAAGTAGAGG - Exonic
1093590622 12:20897727-20897749 GGAGGAGAGCTGGGATGAGGTGG - Intronic
1095077742 12:37952828-37952850 TGTTGTGGGGTGGGAGGAAGGGG + Intergenic
1095274015 12:40257917-40257939 TGGGGCAGGGTGGGATGAGGTGG + Intronic
1095443558 12:42261724-42261746 TGAGAAGGGGTGGGGGGAGGGGG - Intronic
1095874762 12:47068438-47068460 TGGGGTGGGGTGGGATGGGGTGG + Intergenic
1095989219 12:48022902-48022924 TGGAGAGGGGAGGGGTGAAGAGG - Intronic
1096179091 12:49540857-49540879 AGAGGAGGCGTGGGGTGAAGGGG - Intronic
1096476122 12:51910284-51910306 TGAGTGGGAGTGGGATGCAGAGG - Intronic
1096524555 12:52202768-52202790 GGGGGAGGGGTGGGATGAGGGGG + Intergenic
1096729013 12:53591109-53591131 TGAGTAGGGGTGGAGTGAGGAGG + Intronic
1096777750 12:53974309-53974331 GGAGGAGGGGAGGGGTGGAGGGG + Intronic
1097537851 12:60896601-60896623 TGTTGTGGGGTGGGAGGAAGGGG - Intergenic
1097650478 12:62292131-62292153 TGGAGAGGGGTGGGATGGGGGGG + Intronic
1097944255 12:65349054-65349076 TGTGGTGGGGTGGGGAGAAGGGG - Intronic
1098005666 12:65994524-65994546 GGAGGAGGAGGGGGAGGAAGAGG - Intergenic
1098416651 12:70242943-70242965 TGAGGAGGGGAGGAGTGACGAGG + Intergenic
1098542375 12:71671042-71671064 TGAGGAGGAGGAGGAAGAAGGGG + Intronic
1098703372 12:73656848-73656870 TGAGGTGGGATGGGATAATGTGG - Intergenic
1099864419 12:88260877-88260899 TGATAAGGGGTGGGAGGAGGGGG + Intergenic
1099915295 12:88885293-88885315 AGACGTGGGGTGTGATGAAGGGG - Intergenic
1100201244 12:92299907-92299929 GGAGGAGGAGGGGGAGGAAGAGG + Intergenic
1100548275 12:95623702-95623724 TGAGGAGGCGTGGGCGGTAGAGG - Intergenic
1100602067 12:96120669-96120691 AGAGGAGGGGTGGGGAGGAGAGG + Intergenic
1100746410 12:97651279-97651301 TGTGGTGGGGTGGGGTGAGGGGG - Intergenic
1100844517 12:98645012-98645034 GGAGGAGGGGCAGGACGAAGGGG + Exonic
1101253762 12:102957993-102958015 GGAGGAGGGGAGGGAGGAGGAGG + Exonic
1101529971 12:105564810-105564832 TGAGGAGCACTGGAATGAAGAGG - Intergenic
1102120245 12:110434655-110434677 GGAGGAGGGGTGGGAGGGACAGG + Intergenic
1102201279 12:111059599-111059621 TGGGGAGGTGGGAGATGAAGTGG + Intronic
1102408787 12:112698896-112698918 GGAGGAGGGGGAGGAGGAAGGGG - Intronic
1102417303 12:112775050-112775072 TGTTGAGGGGTGGGGTTAAGGGG + Intronic
1102495563 12:113316720-113316742 GGAGGACTGGTGGGATGGAGCGG - Intronic
1102568913 12:113815492-113815514 TGAGCAGAGCTGGGAGGAAGGGG - Intergenic
1102626525 12:114239696-114239718 TGAGAGAGGGTGGAATGAAGGGG - Intergenic
1102655630 12:114480352-114480374 TGAGGAGGAGGAGGAGGAAGGGG + Intergenic
1102737840 12:115179069-115179091 GGAGGAGGAGGGGGAGGAAGAGG + Intergenic
1103235387 12:119368203-119368225 GGAGGAGGAGGGGGAGGAAGAGG + Intronic
1103239010 12:119397996-119398018 TGTGGGGGGATGGGAGGAAGGGG + Intronic
1103417425 12:120752414-120752436 TGAGGAGGTGTGGAAAGAGGAGG + Intergenic
1103566051 12:121816235-121816257 GGTGGAGGGGAGGGATTAAGGGG - Intronic
1104129805 12:125882415-125882437 GGAGGAGGTGAGAGATGAAGAGG + Intergenic
1104204748 12:126627759-126627781 TGAGGAGGGTAGGGAGGAAAGGG + Intergenic
1104218054 12:126754079-126754101 TGAGGAGGTGGGGGAAGAGGCGG + Intergenic
1104719136 12:131034931-131034953 TGTGGAGGGGAGGGCTGAAGGGG - Intronic
1104805855 12:131588632-131588654 TGGGGTGGGGTGGGGTGGAGTGG + Intergenic
1104953018 12:132450977-132450999 GGAGGAGGGGAGGGAGGGAGTGG - Intergenic
1105560338 13:21484587-21484609 GGAGGTGGGGTGGGATGGGGGGG + Intergenic
1105891255 13:24684058-24684080 GGGGGAGGGGTGGGACGAGGTGG - Intronic
1106423228 13:29601284-29601306 GGGGGAGGGCTGTGATGAAGGGG + Intergenic
1106519562 13:30484741-30484763 GGAGGAGGAGTAGGAGGAAGAGG + Intronic
1106811792 13:33365215-33365237 TGGGGAAGGGTGGGAAGAGGTGG + Intergenic
1107316649 13:39139300-39139322 TGTCGTGGGGTGGGAGGAAGGGG + Intergenic
1107430476 13:40335813-40335835 TGTTGTGGGGTGGGAGGAAGGGG + Intergenic
1107444396 13:40457382-40457404 TGGGGAGGGGTGGGAGGAGAGGG - Intergenic
1107888578 13:44894544-44894566 TGAGGAGCCGGGGGAGGAAGTGG - Intergenic
1108106229 13:47013708-47013730 TGGGGAGGAGAAGGATGAAGAGG + Intergenic
1108699044 13:52928041-52928063 TTGGGAGGGGTGGGGTGAAGAGG + Intergenic
1109048286 13:57441407-57441429 TGAGGAGGAGGAGGAAGAAGAGG + Intergenic
1109063769 13:57656778-57656800 TGAATAGGGCTGAGATGAAGAGG + Intronic
1109421909 13:62124265-62124287 AGAGCAGGGGTAGGAAGAAGGGG - Intergenic
1110428150 13:75392599-75392621 GGAGGAGGAGGGGGAAGAAGGGG - Intronic
1110696825 13:78500935-78500957 TGTTGTGGGGTGGGAGGAAGGGG - Intergenic
1111060308 13:83010055-83010077 TAGGGAGGGGAGGGATAAAGTGG - Intergenic
1111717469 13:91897035-91897057 GGAGGAGGGGGAGGAAGAAGAGG - Intronic
1111777361 13:92681416-92681438 TGAGGAGTGGTGGGGTGAGTTGG - Intronic
1111876377 13:93902213-93902235 TGAGGAGGGGAGAGGGGAAGGGG - Intronic
1111929328 13:94497691-94497713 TGAGGAGGAGGAGGAAGAAGAGG + Intergenic
1111930063 13:94503451-94503473 AGAGGAGGGGAGGGAAGAGGAGG + Intergenic
1112430512 13:99346607-99346629 GTGGGAGGGGTGGGGTGAAGGGG - Intronic
1112505265 13:99971188-99971210 GGTGAAGGGGTGGGAGGAAGAGG + Exonic
1113221429 13:108107989-108108011 GGAGGAGGAGGGGGAGGAAGAGG + Intergenic
1113352170 13:109540088-109540110 TGAGGATGAAGGGGATGAAGAGG - Intergenic
1113598997 13:111555014-111555036 GGAGGCTGGGTGGGATGAGGAGG + Intergenic
1113936626 13:113998289-113998311 AGAGGAGGGCTGGGAAGAGGAGG - Intronic
1113966231 13:114155346-114155368 TGAGGAGGGGTGGGGTGTGAGGG + Intergenic
1113966388 13:114155771-114155793 TGGGGAGGGGTGGGGTGCAGAGG + Intergenic
1113997481 14:16100293-16100315 TGGAGTGGGATGGGATGAAGTGG - Intergenic
1114364244 14:22010021-22010043 TGAGGAGGAGAAGGAGGAAGGGG + Intergenic
1114373151 14:22112391-22112413 TTAGGAGAAGTTGGATGAAGAGG + Intergenic
1114749716 14:25189391-25189413 TGTTGTGGGGTGGGAGGAAGGGG + Intergenic
1115009296 14:28524739-28524761 GGAGGAGGAGTGGGAGGATGAGG + Intergenic
1115012146 14:28561811-28561833 GGAAGAGGGGAGGGATGAAGAGG + Intergenic
1115776619 14:36722275-36722297 TGGGGAGGGGAGGGATGAATCGG + Intronic
1117396427 14:55314866-55314888 GGAGAAGTGGGGGGATGAAGTGG - Intronic
1117690059 14:58297812-58297834 GGAGAAGGGGCGGGATGAATGGG - Intronic
1117690063 14:58297825-58297847 TGCGGCGGGGTGGGGAGAAGGGG - Intronic
1117882876 14:60328890-60328912 TGATGAGGGGTGGGGAGAGGAGG - Intergenic
1118236895 14:64014003-64014025 TTAGAAGGGGTGGGAGGAGGAGG - Intronic
1118262331 14:64259332-64259354 TGAGGAGGGGTGAGAAGCTGGGG - Intronic
1118359618 14:65044886-65044908 TGTGTAGGGGTGGGTTGTAGGGG + Intronic
1118459567 14:65976077-65976099 GGAGGAGGAGGGGGAAGAAGAGG + Intronic
1118715332 14:68555809-68555831 TGGTGAGGGGTGGGATGCGGAGG - Intronic
1119180374 14:72601016-72601038 GGAGGAGGGGGAGGAGGAAGAGG + Intergenic
1119329992 14:73786820-73786842 TGAGGTAGGGTGGGGGGAAGGGG - Intronic
1119431362 14:74570097-74570119 GGAGGAGGGGCTGGAGGAAGGGG + Intronic
1119764213 14:77178362-77178384 AGAGGAGGGGAGGGAAGAGGAGG - Intronic
1119764219 14:77178377-77178399 AGAGGAGGGGAGGGAAGAGGAGG - Intronic
1119764225 14:77178392-77178414 AGAGGAGGGGAGGGAAGAGGAGG - Intronic
1119772055 14:77226234-77226256 TGGGTAGGGGTGGGGTGGAGGGG - Intronic
1120274415 14:82353402-82353424 TGTGGTGGGGTGGGGGGAAGGGG + Intergenic
1121419274 14:93801049-93801071 GGAGGAGGGGTAGGGTGAAGCGG + Intergenic
1121869491 14:97394217-97394239 TGTGGTGGGGTGGGAGGAGGGGG - Intergenic
1122078918 14:99253675-99253697 TGAGGAGGGGTGAGGAGAAAGGG - Intronic
1122296680 14:100709840-100709862 GGAGGAGGGGCGGGACGCAGAGG - Intergenic
1122455267 14:101845459-101845481 TGGGGAAGGGTGGGGTGGAGTGG - Intronic
1123105075 14:105837470-105837492 AGAGGAGGGTGAGGATGAAGAGG + Intergenic
1123804842 15:23860394-23860416 GGAGGAGAGGTGGGAGGAAATGG + Intergenic
1123968156 15:25479660-25479682 TGAGGAGGGGAAGGACAAAGAGG + Intergenic
1124059734 15:26278982-26279004 TGGGGAGGGGTGGGAAGTGGAGG - Intergenic
1124087510 15:26564678-26564700 TGGGAAGGGGTGGCAGGAAGGGG + Intronic
1124169409 15:27359205-27359227 TGAGGCCGGGTGGGAAGGAGGGG + Intronic
1124439541 15:29676026-29676048 AGAGGAGGGGAGGGAGGGAGAGG + Intergenic
1124560975 15:30773045-30773067 TGCTGAGGGGTGGGCTGAGGTGG - Intergenic
1124669552 15:31626009-31626031 TGCTGAGGGGTGGGCTGAGGTGG + Intronic
1124810847 15:32936643-32936665 GGAGGGGGAGTGGGAGGAAGAGG + Intronic
1124835670 15:33194348-33194370 TGAGGAGCGTTGGGATGACCCGG + Intronic
1124957751 15:34370842-34370864 GGAGGAGGGAGGGGATGAAGAGG - Intergenic
1124972544 15:34502975-34502997 TGAGGAGTGGTGGGGTGAGTGGG - Intergenic
1125001000 15:34769891-34769913 TGTGGTGGGGTGGGAGCAAGGGG - Intergenic
1125083087 15:35698364-35698386 TGAGGAGGTGTAGGATGTGGTGG + Intergenic
1125513724 15:40306679-40306701 TGATGGGAGGTGGGATGAGGGGG - Intronic
1125744772 15:41990715-41990737 AGAGGAGGGGAGGGAGGGAGGGG - Intronic
1125896039 15:43302387-43302409 AGAGGAGGAGTGGGAGGAGGAGG - Intergenic
1125928691 15:43584357-43584379 TGAGGATGAGGAGGATGAAGTGG - Exonic
1125929340 15:43589510-43589532 TGATGCGGGGTGGGATGGGGAGG - Intronic
1125941857 15:43684192-43684214 TGAGGATGAGGAGGATGAAGTGG - Intergenic
1125942507 15:43689342-43689364 TGATGCGGGGTGGGATGGGGAGG - Intergenic
1126437741 15:48653256-48653278 TGGGGTGGGGTGGGGTGGAGTGG + Intergenic
1126482625 15:49142923-49142945 GGGGGAGGGGTGGGGTGAAGAGG + Intronic
1127531535 15:59847932-59847954 TGGGGAGAGGTAGGAAGAAGGGG + Intergenic
1128096196 15:64958163-64958185 AGAGGAAGGGAGGGATGAGGAGG + Exonic
1128155955 15:65392110-65392132 TGAGGAGGGCTGGGGGGAGGGGG - Intronic
1128304182 15:66587113-66587135 AGAGGAGGGGGAGGAGGAAGGGG - Intronic
1128391151 15:67183512-67183534 TGGGGAGTGGTTGGAGGAAGGGG + Intronic
1128640068 15:69329352-69329374 GAAGGAGGTGGGGGATGAAGGGG + Intronic
1128726626 15:69992691-69992713 TGAGGAGGGGTGTTCAGAAGGGG - Intergenic
1129054612 15:72810115-72810137 TGGGGAGGGGTGGGAAGTAGAGG + Intergenic
1129245113 15:74274549-74274571 TGGGGAGGAGTGGGACAAAGGGG + Intronic
1129334042 15:74842004-74842026 GGGGGAGGGGTGGGATGGTGGGG + Intronic
1129466930 15:75729432-75729454 TGGGGGCGGGTGGGATGGAGAGG - Intergenic
1129564070 15:76603181-76603203 TGTTGTGGGGTGGGAGGAAGGGG - Intronic
1129936453 15:79454145-79454167 TGGGGCGGGGTGGGAAGAAATGG + Intronic
1130007212 15:80111322-80111344 TCTGCAGGGGTGGGATGAGGGGG - Intronic
1130128711 15:81117815-81117837 AGAAGAGGAGTTGGATGAAGAGG - Intronic
1130373264 15:83305500-83305522 TGTGGAGGTGGGGGAGGAAGCGG - Intergenic
1130959808 15:88652349-88652371 TGAGGAGGAGGGGGAGGAGGGGG - Intronic
1130995472 15:88901500-88901522 TGGGGTTGGGTGGGATGAGGTGG - Intronic
1131067052 15:89441359-89441381 GGAGGAGGGAGGGGAGGAAGAGG + Intergenic
1131111046 15:89765683-89765705 AGAGGAGGGGAGGGGAGAAGAGG + Intronic
1131229049 15:90647096-90647118 GGAGGAGGGGTTGGAGGAGGAGG - Intergenic
1131229184 15:90647519-90647541 TGAGGAGGAGGGGGGTGAGGCGG - Intergenic
1131284076 15:91043244-91043266 TGAGGAGGAGGAGGAGGAAGAGG - Intergenic
1131347530 15:91664622-91664644 TGGGGAGGAGTGGGAGGAAGAGG - Intergenic
1131433980 15:92408492-92408514 GAAGGAGGGAAGGGATGAAGGGG + Intronic
1132053763 15:98633933-98633955 GGAGGAGGGGGAGGAGGAAGGGG - Intergenic
1132078607 15:98845421-98845443 GGAGGAGGGAGGGGAGGAAGAGG - Intronic
1132187853 15:99818673-99818695 TGAGGAGTGGTGGGGTGAGTGGG + Intergenic
1132771849 16:1567891-1567913 TGAAGAAGGCAGGGATGAAGAGG + Intronic
1133344880 16:5063188-5063210 TGAGAGGGCGAGGGATGAAGTGG + Intronic
1133480975 16:6170179-6170201 TGAGGAAGGGTATCATGAAGAGG + Intronic
1133551086 16:6855239-6855261 TGAGGAAGGGAGGGAGGGAGAGG + Intronic
1133562568 16:6963647-6963669 TGTGGGAGGGAGGGATGAAGAGG + Intronic
1133742303 16:8660841-8660863 GGAGGAGGGGGAGGAGGAAGAGG + Intergenic
1133882359 16:9794918-9794940 TGAGAAGGAGAAGGATGAAGAGG + Intronic
1133974546 16:10591347-10591369 TGAATAGGGCTGGGTTGAAGAGG - Intergenic
1134056426 16:11173063-11173085 GGAGGTGTGGTGGGGTGAAGGGG - Intronic
1134107428 16:11494318-11494340 TGAGTGGGGGTGGGGTGAAGGGG - Intronic
1134376827 16:13684272-13684294 TGTGGTGGGGTAGGATGATGAGG - Intergenic
1134473417 16:14548959-14548981 GGAAGAGGGGAGGGAAGAAGAGG + Intronic
1135112753 16:19703494-19703516 TGAGGAGATGTGGTAGGAAGGGG + Exonic
1135731734 16:24900310-24900332 TAAGAAAGGGTAGGATGAAGTGG + Intronic
1135833739 16:25803947-25803969 TGAGGAGGAGAGGGAAGGAGAGG - Intronic
1135968901 16:27058018-27058040 TAAGGAGAGGTGATATGAAGGGG + Intergenic
1136070508 16:27784446-27784468 TCAGGAGGGCCGGGAAGAAGGGG + Intergenic
1136089582 16:27908899-27908921 TGGGGTGGGGTGGGAAGAGGAGG - Intronic
1136499699 16:30664277-30664299 TGAGGAGGAGGAGGACGAAGAGG - Exonic
1136684959 16:31988643-31988665 TGAGGAGAGGTGGAAGGGAGGGG + Intergenic
1136849625 16:33602930-33602952 AGAGGAGGGGAGGGAAGAGGAGG - Intergenic
1136884198 16:33921626-33921648 TGAGGAGAGGTGGAAGGGAGGGG - Intergenic
1136903195 16:34063278-34063300 TGAAGTGGAGTGGGGTGAAGTGG + Intergenic
1136906245 16:34096335-34096357 TGCAGAGGAGTGGGGTGAAGTGG - Intergenic
1137044432 16:35642595-35642617 TGAGCAGGTGTGGGGTGAGGTGG + Intergenic
1137281034 16:46976893-46976915 TGTGAAGGGTTGGGATGGAGAGG + Intergenic
1138595080 16:58025563-58025585 TGACGCGGGGTGGGCTGGAGAGG + Exonic
1138623151 16:58227699-58227721 TGAGGAGGAGGAGGAGGAAGAGG - Intergenic
1138680157 16:58678367-58678389 TGGAGAGGGGCAGGATGAAGAGG + Exonic
1138731110 16:59196191-59196213 TGTGGCGGGGGGGAATGAAGGGG - Intergenic
1139136055 16:64206174-64206196 GGGGGTGGGGTGGGGTGAAGTGG + Intergenic
1139227452 16:65246906-65246928 TGTGGAAGGGTGGGTTGACGTGG + Intergenic
1139278288 16:65748396-65748418 TGAGGAGGGGTGAGGGGAGGTGG - Intergenic
1139317746 16:66087656-66087678 TGTGGTGGGGTGGGATGGAGTGG + Intergenic
1139852889 16:69961513-69961535 TGGGCAGGGGTGGCAGGAAGGGG + Intronic
1139881860 16:70184421-70184443 TGGGCAGGGGTGGCAGGAAGGGG + Intronic
1140370650 16:74411085-74411107 TGGGCAGGGGTGGCAGGAAGGGG - Intronic
1140864973 16:79052185-79052207 TGTGGTGGGGTGGGGGGAAGGGG - Intronic
1141053913 16:80798411-80798433 TGAGGAGGAGGAGGAGGAAGGGG - Intronic
1141155532 16:81594090-81594112 TGGGGAGGAGGGGGAGGAAGAGG - Intronic
1141683136 16:85555584-85555606 TGAGGAGGGGCGGGGTGGCGGGG - Intergenic
1141772125 16:86095927-86095949 TGAGGAGTGGTGGGAGGCACTGG - Intergenic
1141792256 16:86244689-86244711 TGGGGAGGGGTGGGCTACAGGGG + Intergenic
1141891787 16:86930951-86930973 AGAGGAGGAGAGGGATGAAGAGG - Intergenic
1141891806 16:86931005-86931027 AGAGGAGGAGTGGGATGAAGAGG - Intergenic
1141891810 16:86931023-86931045 GGAGGAGGGGGTGGAGGAAGAGG - Intergenic
1142164281 16:88577414-88577436 CGAGGAGGAGGGGGACGAAGGGG + Exonic
1142387985 16:89778954-89778976 TGAGCAGGGCGGGGAGGAAGTGG + Exonic
1142885837 17:2911684-2911706 GGAGGTGGGGTGGGATGGGGCGG + Intronic
1142953487 17:3504100-3504122 TGAGGTGGGGTGGGAGGTGGAGG - Intronic
1142998291 17:3774267-3774289 TGGGCTGGGGTGGGATGAGGAGG + Intronic
1143179446 17:4974973-4974995 TGCGGGGGGCTGGGAGGAAGGGG - Intronic
1143555256 17:7655898-7655920 AGAGATGGGGTGGGAGGAAGGGG - Exonic
1143691243 17:8568001-8568023 GGGAGAGGGTTGGGATGAAGAGG - Intronic
1143778947 17:9219379-9219401 GGAGCAGGGGTGTCATGAAGGGG + Intronic
1144045726 17:11452935-11452957 TGAGAAGGAGAGGGAGGAAGAGG - Intronic
1144140099 17:12340106-12340128 TGAGGGGAGGTGGGGTGAGGGGG - Intergenic
1144439981 17:15272638-15272660 CCGGGAGGGGTGGGATGCAGAGG + Intergenic
1145291067 17:21546223-21546245 GCAGGAGGGGAGGGAGGAAGCGG - Intronic
1145780647 17:27560752-27560774 GGAGGAGGGGTGGGAAGGAGAGG - Intronic
1145824254 17:27865167-27865189 TGAGGAAGAGGGGGAAGAAGAGG + Intronic
1145938226 17:28727170-28727192 AGAGGAGGGGCGGGAAGAAGCGG + Intronic
1145939804 17:28737455-28737477 TGAGGAGGGCACGGATGCAGAGG - Exonic
1146005691 17:29159238-29159260 TGTGGAGTAGTGGGATGCAGGGG - Intronic
1146692182 17:34884091-34884113 TTGGGAGGTTTGGGATGAAGTGG + Intergenic
1146750461 17:35373822-35373844 GGAGGAAGGGTGGGAAGAAGGGG - Intergenic
1147214486 17:38891193-38891215 TGAGGTGGGGTGGGGTGGGGCGG + Intronic
1147343950 17:39774389-39774411 AGAGGAGGGGAGGGAACAAGAGG + Intronic
1147364643 17:39952166-39952188 TGATGGTGGGTGGGATGCAGAGG + Intergenic
1147439048 17:40436333-40436355 AGAGGAAGGTTGGGATGAAGTGG + Intergenic
1147484815 17:40802338-40802360 TGTGGAGGGTGGGGATGAAGAGG + Intergenic
1147703466 17:42410318-42410340 AGAGGAGGGGAGAGGTGAAGGGG + Intronic
1147970333 17:44215995-44216017 GGAAGAGGGGTGGGAGGAAGGGG + Intronic
1148382576 17:47210381-47210403 GGGAGAGGGGTGGGCTGAAGAGG + Intronic
1148487147 17:47997868-47997890 TGAGGGGGTGGGGGAGGAAGTGG - Intergenic
1148623771 17:49053785-49053807 TGATGAGAGGTGGGAGGAAGGGG - Exonic
1148684002 17:49490604-49490626 AGAGGAGGGGTGAAATGAGGTGG - Intergenic
1149115896 17:53096453-53096475 AGAGGAGGAGTAGGAGGAAGAGG + Intergenic
1149250333 17:54760856-54760878 TGTGGAGGGGTGAAATGGAGTGG - Intergenic
1149289383 17:55201411-55201433 AGAGGAGGGGAGGGAAGGAGAGG + Intergenic
1149435228 17:56628290-56628312 TGGGGAGGAGTGGGAGGCAGAGG + Intergenic
1149469394 17:56903494-56903516 GGAGGAAGGATGGGAGGAAGAGG + Intronic
1149498084 17:57132119-57132141 TGAGGGTGGGTGGGCTGGAGGGG + Intergenic
1149498267 17:57132599-57132621 TGAGGGTGGGTGGGCTGGAGGGG + Intergenic
1149498289 17:57132647-57132669 TGAGGGAGGGTGGGCTGGAGGGG + Intergenic
1149633901 17:58150683-58150705 TGAGGAGGGGAGGAATCCAGCGG + Intergenic
1150249670 17:63698980-63699002 GGAGGAGGGGTGTGAGGGAGCGG - Intronic
1150458874 17:65330500-65330522 CCAGCAGGAGTGGGATGAAGGGG + Intergenic
1150487530 17:65554248-65554270 TGAGGAGGAGGAGGAGGAAGAGG - Intronic
1150765004 17:67995696-67995718 TGTGGAGGGCTGGGGGGAAGCGG - Intergenic
1150903612 17:69312622-69312644 TAAGGAGTGCTGGAATGAAGTGG + Intronic
1151186385 17:72367201-72367223 TGAGGAGGGCTGGTGTGAATTGG + Intergenic
1151366945 17:73623700-73623722 TGGGGCGGGGTGGGGTGCAGTGG - Intronic
1151398223 17:73839038-73839060 TGAAGAGGGCTGGGATTGAGCGG - Intergenic
1151429907 17:74055486-74055508 TGGGGTGGGGTGGGATGGGGAGG - Intergenic
1151446557 17:74169666-74169688 TTAGAAGGGGTGGGGAGAAGAGG + Intergenic
1151685945 17:75646696-75646718 TGTGGAGGGCTGAGCTGAAGAGG - Exonic
1151708416 17:75785074-75785096 GGAGGAAGGGGGGGAGGAAGAGG - Intronic
1152277620 17:79367334-79367356 GGAGGAGGAGGGGGAGGAAGAGG - Intronic
1152317815 17:79591074-79591096 TGAGCAGGCTTGGGAGGAAGGGG - Intergenic
1152336631 17:79702851-79702873 GGAGGAGGGGGAGGAGGAAGGGG - Intergenic
1152336689 17:79703023-79703045 GGAGGAGGAGTGGGAGGAAGGGG - Intergenic
1152410420 17:80120238-80120260 TGAGGAGGGGAGGGGAGGAGGGG - Intergenic
1152635226 17:81428154-81428176 AGTGCAGGGGTGGGAGGAAGGGG - Intronic
1152750391 17:82059891-82059913 GGAGGATGGGGGTGATGAAGAGG + Intronic
1152902566 17:82951793-82951815 TGAGGAGGGGTGGGGTGGGGGGG + Intronic
1203213571 17_KI270730v1_random:103080-103102 TGAAGTGGAGTGGGATGAAGTGG + Intergenic
1153480053 18:5538679-5538701 TGAAGAGGGGAGGGATCAAATGG - Intronic
1153499183 18:5730874-5730896 TCAGGAGGGGTTGGAGGAAAAGG - Intergenic
1153670094 18:7403283-7403305 TGTGGTGGGGTGGGGTGAGGGGG + Intergenic
1153680650 18:7497379-7497401 AGAGGAGGAGAGGGAGGAAGAGG + Intergenic
1153794090 18:8607074-8607096 TGAGGAGGAGGAGGAGGAAGAGG + Intergenic
1153873736 18:9346133-9346155 GGAGGTAGGGAGGGATGAAGAGG - Intronic
1154026877 18:10716246-10716268 TGAGGAGGAGGAGGAAGAAGAGG - Intronic
1154042957 18:10876831-10876853 TGAGCAGTGGTGGGTTGAGGAGG - Intronic
1154177984 18:12100387-12100409 TGAGGAGGAGTAGGAGGTAGAGG + Intronic
1154299279 18:13178799-13178821 TGAGGAGGAGAAGGAGGAAGAGG - Intergenic
1154321694 18:13359252-13359274 TGAGGAGTTGAGGGATGGAGAGG + Intronic
1155168763 18:23251519-23251541 CGAGGAGGGATGAGATGAACTGG + Intronic
1155328386 18:24689325-24689347 TGAGAAGGGGAGGGATGCTGGGG + Intergenic
1155345436 18:24852849-24852871 TGAGGTGGGCTTGGATGAATGGG + Intergenic
1155358702 18:24979322-24979344 TGGGGAGGGGCGGGGAGAAGAGG + Intergenic
1155407004 18:25500126-25500148 AGTGGAGGGGTGGGATGGAGGGG + Intergenic
1155476325 18:26238735-26238757 TGTCGTGGGGTGGGAGGAAGGGG - Intronic
1155640549 18:28008590-28008612 TGTCGTGGGGTGGGATGAGGGGG + Intronic
1155845201 18:30696315-30696337 TGTGGAAGGGTGGCATGAACAGG + Intergenic
1156012688 18:32512857-32512879 TGAGGAGGGACGGGAAGTAGAGG + Intergenic
1156190873 18:34719038-34719060 TAAGTAGTGGTGGGATGCAGTGG + Intronic
1156325063 18:36067484-36067506 TGGGGAAGGGTGGGGTGAGGGGG - Exonic
1156466096 18:37348602-37348624 TGAGGTGGGGTGGGACGGTGGGG + Intronic
1156489494 18:37487745-37487767 GGATGAGGGGAGGGAGGAAGAGG + Intronic
1156746210 18:40394546-40394568 TTAAGAGGGGTGGCAGGAAGGGG - Intergenic
1156940031 18:42755966-42755988 TGAGGGGAGGTGGGATGCTGGGG + Intronic
1157075092 18:44457110-44457132 TGAGGAGGGGAGGGAAGGAAAGG - Intergenic
1157084997 18:44570994-44571016 GGAGGAGGGGAGAGAGGAAGGGG + Intergenic
1157104063 18:44756660-44756682 TGAGGAGGGGAGGGAAGAGAAGG - Intronic
1157286019 18:46377988-46378010 AGAGGAGGGGTGGGTTTAAGAGG + Intronic
1157376071 18:47166537-47166559 AGAGGAGGGGGAGGAGGAAGGGG + Intronic
1157382541 18:47232550-47232572 AGAGGAGGGATGGGGTGAAAGGG - Intronic
1157426617 18:47589819-47589841 TGAGGAGGGGGTGGATCATGAGG + Intergenic
1157426977 18:47592472-47592494 TGAGGAGGAGTGGGGAGGAGAGG - Intergenic
1157437877 18:47686585-47686607 TGAGCTGGGGTGGGAGGGAGTGG - Intergenic
1157477781 18:48034490-48034512 GGAAGAGGGCTGGGAGGAAGGGG - Intronic
1157477788 18:48034505-48034527 GGAGGAGGGCTGGGAGGAAGAGG - Intronic
1157570776 18:48710551-48710573 GGAGGAGGGATGGGAAGAGGTGG + Intronic
1157584328 18:48791515-48791537 TGAGGCTGGGTGGGAGGGAGGGG - Intronic
1157598537 18:48878519-48878541 AGAGGACCTGTGGGATGAAGGGG + Intergenic
1157867103 18:51196966-51196988 CGAGGAGGAGGGGGAGGAAGCGG - Exonic
1158516902 18:58138338-58138360 GGAGGAGGGGAGGGAAGAGGAGG - Intronic
1158516909 18:58138356-58138378 GGAGGAGGGGAGGGAAGAGGAGG - Intronic
1158847289 18:61458065-61458087 AGAGAAGGGGCAGGATGAAGAGG - Intronic
1158976607 18:62716045-62716067 TGAGGAGAGGGCGGCTGAAGAGG + Exonic
1159079801 18:63724307-63724329 TGAGGAGGATTGGGGAGAAGAGG - Intronic
1159080367 18:63729483-63729505 AGAGGAAGGGAGGGATGAATAGG + Intergenic
1159561299 18:69997787-69997809 TGAGCAGGGGAGGGACAAAGTGG + Intergenic
1159609014 18:70506024-70506046 TGGGGCTGGGTGGGGTGAAGTGG - Intergenic
1159706963 18:71702634-71702656 TGGGGAAGGGAGGAATGAAGAGG + Intergenic
1159718180 18:71851104-71851126 TGAGAAAGGGTGGGAAGAACAGG - Intergenic
1159833121 18:73303044-73303066 TGAGGGGGAGAGGAATGAAGAGG - Intergenic
1159899032 18:74025108-74025130 TGAGGAGGGAGGGGAGGAAAGGG - Intergenic
1159959109 18:74541692-74541714 TGATTAGGGCTGGGACGAAGGGG - Intronic
1160435962 18:78853094-78853116 AGAGGAGGCGTGGCTTGAAGAGG + Intergenic
1160565433 18:79784066-79784088 GGAGGAGGGGGAGGAAGAAGAGG + Intergenic
1160710741 19:549864-549886 TGAGGACGGGTGGGAGGGACAGG + Exonic
1160819722 19:1052373-1052395 GGAGGAGGAGGGGGAGGAAGCGG + Intronic
1160835277 19:1122041-1122063 AGAGGAGGGGTGGGAGTCAGGGG - Intronic
1160965287 19:1744663-1744685 TGGGGAGGAGGGGGAGGAAGAGG - Intergenic
1160965712 19:1746140-1746162 AGAGGAGGAGTGGGAAGAATGGG + Intergenic
1160965785 19:1746331-1746353 GGAGGAGGAGGGGGAGGAAGGGG + Intergenic
1161070028 19:2255438-2255460 TGAGGAGGGGTGGGAGGACGGGG - Intronic
1161080201 19:2306775-2306797 TGATGTGGGGTGGCAGGAAGGGG - Intronic
1161267890 19:3373410-3373432 AGAGGAGGGGAGGGTTGAGGAGG - Intronic
1161465824 19:4429734-4429756 TGATGAGGAGTGGGAAGAAGAGG + Exonic
1161566670 19:5006341-5006363 TGAGGAGGGGTGGGAGGAGCAGG - Intronic
1162038095 19:7953335-7953357 GGAGGAGGAGAGGGAGGAAGAGG - Intergenic
1162437165 19:10668208-10668230 TGAGGGGGCATGGGATGAAAAGG - Intronic
1162583411 19:11544591-11544613 TGAGGAGGCTGGGGCTGAAGAGG - Intronic
1162735713 19:12745853-12745875 TGAGAAGGGGTGGGAAGGAAAGG - Intronic
1162808610 19:13151506-13151528 AGAGGAGAGATGGGATGAAGGGG + Intronic
1162969875 19:14174223-14174245 TTTGGAGAGGTGGGAGGAAGGGG + Intronic
1163112423 19:15169824-15169846 TGGGGAGGGGCAGGATGGAGGGG + Intronic
1163167084 19:15506004-15506026 AGAGGAGGGGAGGGCAGAAGTGG - Intergenic
1163314457 19:16532546-16532568 TGAGGAGGAGCGCGAGGAAGTGG + Intronic
1163712020 19:18852632-18852654 AGAGGAGGGGAGGGAGGGAGGGG - Intronic
1163782384 19:19257326-19257348 TGAGGAGGAGGGGGAGGAGGAGG + Exonic
1163833949 19:19562253-19562275 GGAGGAGGGAAGGGATGGAGGGG + Intronic
1164567688 19:29339568-29339590 GGAGGAGGAGTAGGAAGAAGGGG + Intergenic
1164592108 19:29512788-29512810 GGAGGAGAGGGGGGATGAGGAGG + Intergenic
1164868671 19:31625744-31625766 GGAGGAGGGGGAGGAGGAAGAGG - Intergenic
1164969316 19:32517562-32517584 AAAGGAGGGGCTGGATGAAGAGG - Intergenic
1165080506 19:33303497-33303519 TGGGGAGGCGGGGGAGGAAGCGG - Intergenic
1165258515 19:34594468-34594490 CGAGCAGGGCTGGGAGGAAGCGG - Intronic
1165360817 19:35335910-35335932 TGGAGAGAGGTGGAATGAAGTGG + Intronic
1165391075 19:35539260-35539282 TGAATAGGTGTGGGTTGAAGGGG - Intronic
1165432484 19:35780676-35780698 TGGGGAGGGGTGGGAAGGGGTGG + Intronic
1165690928 19:37862558-37862580 GGAGGAGGGGTGGGGGGAGGAGG + Intergenic
1165939052 19:39406344-39406366 TGAGGAAGGGAGGGAAGACGGGG - Intergenic
1166316616 19:41993132-41993154 TGGGGGTAGGTGGGATGAAGAGG - Intronic
1166716740 19:44973252-44973274 TGTGGAGGGGTGGAATGTGGAGG + Intronic
1166808015 19:45498538-45498560 GAAGGAGGGGAGGGAGGAAGAGG + Exonic
1166859582 19:45802063-45802085 TGGGGAGGGCTGGGAAGAAAGGG - Intronic
1167145102 19:47676586-47676608 TGAGGGGGGGAAGGAGGAAGGGG - Intronic
1167465303 19:49647526-49647548 GGAGGAGGGGTTGGAGGGAGAGG + Intronic
1167469209 19:49666081-49666103 TGACGAGGGGTGGGGTGAGGAGG + Intronic
1167483666 19:49747660-49747682 CGAAGAGAGGTGGGAGGAAGTGG - Intronic
1167522447 19:49963560-49963582 TGAGTAGGTGGGGAATGAAGAGG - Intergenic
1168240702 19:55087463-55087485 TGGGTAGGGTTGGGATGACGAGG + Intronic
1168241445 19:55091110-55091132 TCAGGAGGGGAGGGGTGACGGGG + Exonic
1168370386 19:55828261-55828283 TGTGGTGGGGTGGGGGGAAGGGG + Intronic
1168510125 19:56967256-56967278 AGAGGAGGGGGAGGAAGAAGGGG - Intergenic
1168517107 19:57017648-57017670 TGAGGAGGGGAGGGAAGGAGAGG - Intergenic
1168517133 19:57017714-57017736 TGAGGAGGGGAGGGAAGGGGAGG - Intergenic
1168517147 19:57017749-57017771 TGAGGAGGGGAGGGAAGGAGAGG - Intergenic
1168517160 19:57017783-57017805 TGAGGAGGGGAGGGAAGGGGAGG - Intergenic
925043695 2:754359-754381 TGTGGTGGGGTGGGGGGAAGGGG + Intergenic
925045533 2:770631-770653 TGAGGAGGAGGGGGGAGAAGAGG + Intergenic
925191254 2:1885574-1885596 CGAGGTGGGGTGGGATGATTGGG + Intronic
926054560 2:9766830-9766852 TGAGGAGGGGGAGGAAGAGGAGG - Intergenic
926175863 2:10591595-10591617 GGAGGAGGGGGAGGAAGAAGAGG + Intronic
926266818 2:11330817-11330839 GGAGGAGGAGGGGGAGGAAGAGG + Intronic
926266827 2:11330839-11330861 GGAGGAGGAGGGGGAGGAAGAGG + Intronic
926417714 2:12666262-12666284 TGAGGAGGGGTGGGTTGGGTCGG - Intergenic
926620143 2:15040071-15040093 TGAGCAGGGTTGGGCTGCAGGGG - Intergenic
927244580 2:20947193-20947215 TGTGGGGTGGTGGGATGGAGGGG + Intergenic
927433694 2:23048701-23048723 TGTGGAGTGGTAGGAGGAAGTGG - Intergenic
927894886 2:26775302-26775324 GGGGGAATGGTGGGATGAAGTGG - Intronic
928628621 2:33167675-33167697 GGAGGTAGGTTGGGATGAAGAGG + Intronic
928716129 2:34062942-34062964 TAGGGAAGGGTGGGAGGAAGCGG + Intergenic
929065705 2:37972721-37972743 TGGGGAGAGGTGGGGAGAAGTGG + Intronic
929435104 2:41922858-41922880 TGAGGAAGGGTGGGTTGAAGAGG - Intergenic
929461128 2:42102633-42102655 TGAGGCGGGGTGGGGTGGGGGGG - Intergenic
929585073 2:43108494-43108516 AGAGGAGGGGAGTGAGGAAGGGG + Intergenic
929608809 2:43254514-43254536 TAGGGTGGGGTGAGATGAAGCGG - Intronic
929949113 2:46392930-46392952 TGAGGAGGGGTGAAGGGAAGCGG + Intergenic
929957793 2:46472196-46472218 TGTTGAGGGGTGGGGGGAAGGGG - Intronic
930019025 2:46989981-46990003 TGCGGTGGAGTGGGAAGAAGGGG + Intronic
930093230 2:47546917-47546939 TGAGAAGGGGAGGGAGGGAGGGG + Intronic
930184062 2:48394149-48394171 TGAGGAGGGTTGGGTGGATGTGG + Intergenic
930364646 2:50424166-50424188 GGAGGAGGGGGAGGAGGAAGAGG + Intronic
930771456 2:55134321-55134343 TCAGGAGGAGTGGGGGGAAGAGG - Intergenic
931512830 2:63019737-63019759 AGAGGAGGGGAGGGAAGAGGAGG + Intronic
931922944 2:67040596-67040618 AGGGGAGGGATGGGATGAATAGG - Intergenic
932066081 2:68562229-68562251 GAAGGAGGGGTGGGTTGGAGAGG + Intronic
932334546 2:70922614-70922636 TGAGAAGGGGTGAGAGGCAGAGG + Intronic
932407330 2:71522182-71522204 AGAGGAGGGGTGGGGAGAAATGG - Intronic
932434915 2:71697491-71697513 TCAGGAGGGGTGGGGTGGTGAGG + Intergenic
932468444 2:71938841-71938863 TGAGCAGGGGTGGGGTGTGGTGG - Intergenic
932566470 2:72914378-72914400 TGAAGATGGGTGGGATGTAGTGG + Intergenic
932742899 2:74305677-74305699 GAGGAAGGGGTGGGATGAAGAGG - Intronic
932993128 2:76812783-76812805 GGAGGAGGGGGGGGAGGGAGAGG - Intronic
933722921 2:85409740-85409762 GGAGGTGGGGAGGGAGGAAGTGG - Intronic
933808828 2:86019245-86019267 TGAGGAGTGGATGGATGAACAGG + Intergenic
934562620 2:95320941-95320963 TGGGGAGGGGTGGGGAGGAGAGG - Intronic
934608680 2:95718291-95718313 TGAGAAAGGATGGGATGAAAAGG - Intergenic
934673721 2:96234397-96234419 GGAGGAGGGCTGGGTTGAGGAGG - Intergenic
934886573 2:98030557-98030579 TGAGGAGGGAAAGGATGAATAGG - Intergenic
935164493 2:100558401-100558423 TGAGGAGGGAGCTGATGAAGTGG - Intergenic
936005744 2:108885753-108885775 TCATGAGTGGTGGGAGGAAGAGG - Intergenic
936541975 2:113359734-113359756 TGAGAAAGGTTGGGATGAAAAGG - Intergenic
937160849 2:119759839-119759861 GGAGGAGGAGGGGGAGGAAGAGG + Exonic
937379557 2:121364288-121364310 TGGGGAGGGGCTGGAGGAAGGGG - Intronic
937569626 2:123340479-123340501 TGAGGAGGAGGGGGAAGAAGAGG - Intergenic
937599025 2:123706347-123706369 TGTGGTGGGGTGGGGGGAAGGGG + Intergenic
938250706 2:129813413-129813435 AGAGGAGGGGTGGGTAGTAGGGG + Intergenic
938323020 2:130377772-130377794 AGGGCAGGGGTGTGATGAAGTGG - Intergenic
938539912 2:132277399-132277421 TGAGGAGGAGTGGGGTGGGGTGG - Intergenic
938770480 2:134496953-134496975 GGAGGAGGCGTGGGAAGAGGAGG - Intronic
939656108 2:144827477-144827499 GGAGGAGCAGTGGGATGAGGGGG + Intergenic
939982249 2:148795834-148795856 TGAGCAGGGGTAGGATGCAGAGG - Intergenic
940539749 2:154997037-154997059 AGAGGAAGGAAGGGATGAAGAGG + Intergenic
940665455 2:156602913-156602935 GAAGGAGGGGTGGAGTGAAGAGG + Intronic
941664103 2:168226611-168226633 TGAGGTGGGGTGGGATGGTTGGG - Intronic
941949573 2:171139819-171139841 TGGGGTGGGGTGGGGTGGAGTGG + Intronic
942106967 2:172642775-172642797 GGAGGAGGAGTGGGAGGAGGAGG - Intergenic
942106987 2:172642865-172642887 GGAGGAGGAGTGGGAGGAGGAGG - Intergenic
942807300 2:179946477-179946499 AGGGGAGGGGAGGGAGGAAGGGG + Intronic
943066382 2:183090907-183090929 TCAGGAGGGGAGGGCTGACGGGG + Intronic
943728161 2:191273469-191273491 TGAGGAGGGTTGGTAGGAAGAGG - Intronic
944563657 2:200965885-200965907 TGAGAAGGAGAGGAATGAAGGGG - Intergenic
945097177 2:206230927-206230949 GGCTGAGGGGTGGGGTGAAGAGG - Intergenic
945269363 2:207923249-207923271 TGAGGAGGGGTGCCATGGGGAGG + Intronic
945688023 2:212996272-212996294 TGCAGAGGGGTGGGGTGAGGAGG + Intergenic
945702409 2:213188484-213188506 TGAAGAGGGGAGGTCTGAAGTGG + Intergenic
945758174 2:213876665-213876687 TGAGAAGGGGAAGGATGGAGGGG - Intronic
945988767 2:216375649-216375671 TTAGGAGAGGTGGGAAGAGGGGG + Intergenic
946173684 2:217910050-217910072 TGAGGCAGGGTGGGCTGGAGAGG - Intronic
946331083 2:219009686-219009708 TGGGGTGGGATGGGATGGAGTGG + Intronic
946331146 2:219009840-219009862 TGGGGTGGGATGGGATGGAGTGG + Intronic
946519150 2:220446764-220446786 TGAAGAAGGGAGGGAGGAAGGGG - Intergenic
946658000 2:221969799-221969821 GGGGAAGGGGTGAGATGAAGGGG - Intergenic
947232695 2:227903692-227903714 TGGGCTGGGGTGGGAGGAAGGGG - Intronic
947375309 2:229489527-229489549 TGAGGAGGAGGGGGAGGAAGAGG + Intronic
947549577 2:231037113-231037135 CGAGGTGGGGTGGGAGGTAGGGG - Intergenic
947744860 2:232502255-232502277 GGGGGAGGGGTGGGAGGAGGGGG + Intergenic
947778288 2:232732967-232732989 TGAGGAGGGGCGGGGCGCAGTGG + Intronic
947837640 2:233187331-233187353 GAGGGAGGGGTGGAATGAAGGGG + Intronic
947885840 2:233570312-233570334 TGAGGAGGGGTGGGGGTAGGGGG - Intergenic
948720806 2:239898956-239898978 TGTGGCAGGGTGTGATGAAGAGG + Intronic
948720839 2:239899083-239899105 TGTGGAGGGGTGTGGTGGAGGGG + Intronic
948720876 2:239899210-239899232 TGTGGAGGGGTGTGGTGGAGGGG + Intronic
948720922 2:239899376-239899398 TGTGGAGGGGTGTGGTGGAGAGG + Intronic
948720936 2:239899438-239899460 TGTGGAGGGTTGTGATGGAGGGG + Intronic
949028265 2:241776397-241776419 GGAGGAGGGGGAGGAAGAAGAGG + Intergenic
1168886344 20:1260982-1261004 TGAGGAGGAGAAGGAGGAAGAGG + Intronic
1168921305 20:1538233-1538255 TGAGAAGGGGTGGAATGAAAGGG + Intronic
1169262322 20:4148349-4148371 TGGGGAGGGGTGAGGAGAAGAGG + Intronic
1169359860 20:4938869-4938891 TGAGAAGGGGTGAGATGAAGGGG - Intronic
1169451512 20:5716028-5716050 TGAGGAGGTGGAGGAGGAAGAGG + Intergenic
1169475009 20:5923275-5923297 TGAGGAGAGTTGGGATGAGGAGG + Exonic
1169654621 20:7909066-7909088 TCAGCAGGGGTGGGGTGAAAGGG + Intronic
1169699840 20:8433702-8433724 TGAGGAGGAGGAGGAGGAAGAGG - Intronic
1170041581 20:12045217-12045239 TTAGGAGGGGAGGGAAGAGGAGG - Intergenic
1170041610 20:12045282-12045304 TGAGGAGGGAAGGGGTGAGGAGG - Intergenic
1170041616 20:12045297-12045319 TGAGGAGGGAAGGGGTGAGGAGG - Intergenic
1170041622 20:12045312-12045334 TGAGGAGGGAAGGGGTGAGGAGG - Intergenic
1170041628 20:12045327-12045349 TGAGGAGGGGAGGGGTGAGGAGG - Intergenic
1170041635 20:12045342-12045364 AGAGGAGGGGAGGGGTGAGGAGG - Intergenic
1170506508 20:17031175-17031197 TGAGTAGGGGTGGGAGGGGGTGG + Intergenic
1170524213 20:17221458-17221480 TGAGGATGGGTGGTGTGAAGGGG + Intergenic
1170666847 20:18393989-18394011 AGAGGAAGGGTGGGAAGGAGAGG + Intronic
1170840970 20:19924334-19924356 TGAAGAGGTGGGGTATGAAGAGG - Intronic
1170840986 20:19924392-19924414 TGAAGAGGTGGGGTATGAAGAGG - Intronic
1170884568 20:20329132-20329154 TGAGGGGTGGTGGGATCAGGGGG - Intronic
1171051617 20:21864835-21864857 AGAGGAGGGAGGGGATGAGGAGG + Intergenic
1171204256 20:23266877-23266899 GAAGGGGGGGTGGGAGGAAGGGG + Intergenic
1172519103 20:35555938-35555960 TGCGGAGATGTGGGAGGAAGGGG - Intronic
1172572584 20:35982156-35982178 TGTGGAGGGGGAGGAGGAAGAGG + Intronic
1173014437 20:39212120-39212142 TGAGGAGGGAAGACATGAAGAGG + Intergenic
1173437976 20:43049785-43049807 TGAGCAGGGCAGGGATGAACAGG - Intronic
1173575956 20:44113095-44113117 TGGGGCAGGGTGGGAGGAAGGGG + Exonic
1173681775 20:44886704-44886726 TGGGGAGCGGAGGGAAGAAGAGG + Intronic
1173918640 20:46727682-46727704 TGAGGTGTGGTGGGATGGGGTGG + Intronic
1174150383 20:48482179-48482201 GGAGGAGGAGGGGGATGAGGAGG + Intergenic
1174352739 20:49980081-49980103 TGAGGAGGGGAGGCAAGAACAGG - Intergenic
1174601574 20:51729327-51729349 GGAGGTGGGGTGGGGTGGAGGGG - Intronic
1175237732 20:57525637-57525659 GGGGGAGGGGTGGAATGAGGGGG + Intronic
1175237740 20:57525657-57525679 GGGGGAGGGGTGGAATGAGGCGG + Intergenic
1175237805 20:57525832-57525854 GGGGGAGGGGTGGAATGAGGAGG + Intergenic
1175237933 20:57526183-57526205 GGGGGAGGGGTGGAATGAGGAGG + Intergenic
1175237995 20:57526352-57526374 GGGGGAGGGGTGGAATGAGGAGG + Intergenic
1175392760 20:58637503-58637525 TGGGAAGGGGTGGGCAGAAGGGG - Intergenic
1175410162 20:58762459-58762481 AGAGGAGGGATGGGATCAGGTGG + Intergenic
1175835011 20:61988053-61988075 ACAGGAGGGGAGGGATGAACGGG + Intronic
1175874765 20:62224136-62224158 AGAGGAGGGGTGGGAGGGGGTGG + Intergenic
1175934981 20:62510237-62510259 TGAAGGGTGGTGGGATGGAGGGG - Intergenic
1175935010 20:62510313-62510335 TGGAGAGTGGTGGGATGGAGGGG - Intergenic
1176321410 21:5329101-5329123 TGAAGTGGAGTGGAATGAAGTGG + Intergenic
1176529409 21:7946515-7946537 TGGAGAGGAGTGGAATGAAGTGG - Intergenic
1177592917 21:23195576-23195598 AGAGGAGGGATGGAATGAGGTGG + Intergenic
1177758282 21:25373629-25373651 GGAGGAGGGGTGGGGAGAGGAGG - Intergenic
1178368609 21:32008622-32008644 TGAGGAGTGTTTGAATGAAGAGG + Intronic
1179021767 21:37647329-37647351 TGAGTAGGGTCGGGATGGAGGGG + Intronic
1179084913 21:38207771-38207793 GGAGGAGTGGAGGGAAGAAGAGG - Intronic
1179084990 21:38207987-38208009 AGAGGAGGGGAGGAAAGAAGAGG - Intronic
1179143135 21:38744816-38744838 TGAGCAGGGGCCGGATGCAGTGG - Intergenic
1179305068 21:40146208-40146230 TGAGTATGGGTGGTCTGAAGTGG + Intronic
1179495566 21:41769385-41769407 TGAGGAGGGGAGGGACGACGAGG + Intergenic
1179504151 21:41828858-41828880 TGAGGAGGATTTGGGTGAAGGGG - Intronic
1180162400 21:46004038-46004060 TGGGGAGGGGTGGGAGGACAGGG - Exonic
1180952796 22:19728334-19728356 TGGGGAGGGATGGCAGGAAGAGG - Intergenic
1181179197 22:21055342-21055364 AGAGGCTGGGAGGGATGAAGGGG - Intronic
1181542207 22:23579596-23579618 GGAGGAGGAGTGGGAGGAGGAGG + Intronic
1181589614 22:23876098-23876120 TGAGGAGGGGAGGGAGAGAGAGG + Intronic
1181593110 22:23896598-23896620 TGAGGCGGGGTGGGAGCCAGGGG - Intronic
1181619343 22:24077822-24077844 AGTGAAGGGGTGGGCTGAAGGGG + Intronic
1181976799 22:26736334-26736356 TGAGATGGGATGGGATGAGGTGG - Intergenic
1181976910 22:26736744-26736766 TGAGAGGGGGTGGGATGAGAAGG - Intergenic
1182021538 22:27085784-27085806 TGAGGAAGGGGAGGATGCAGAGG - Intergenic
1182265708 22:29113637-29113659 TGAGAAGGGCTGTGATGGAGAGG + Intronic
1182521116 22:30884977-30884999 TGAGGAGTGGTGGGAGTTAGTGG + Intronic
1182572264 22:31248307-31248329 TGAGGGAGGGAGGGAGGAAGAGG - Intronic
1182586474 22:31346632-31346654 TGGGGAGGGGGGGCAGGAAGCGG - Intergenic
1183025594 22:35063927-35063949 TGGGGTGGGGTGGGAGGAAGGGG - Intergenic
1183247092 22:36702318-36702340 AGGGGAGGGGTGGGGTGGAGAGG + Intronic
1183352284 22:37341039-37341061 GGAGAAGGGGAGGGATAAAGAGG + Intergenic
1183520333 22:38293153-38293175 TGTGGAGGGGTGGGTGGCAGTGG - Intronic
1184073390 22:42161100-42161122 GGGGGAGGGGTGGGATGATGGGG - Exonic
1184499126 22:44861402-44861424 TGAGGAGGGGTGGCCTGCAGTGG + Intronic
1184561641 22:45267266-45267288 AGAGGGGAGGGGGGATGAAGAGG + Intergenic
1184712071 22:46256752-46256774 TGAGGAGCCATCGGATGAAGTGG - Exonic
1184741941 22:46433586-46433608 TGGGGAGGGGAGGGAGGACGTGG - Intronic
1184933691 22:47702166-47702188 AGAGGAGGGGAAGGAGGAAGAGG - Intergenic
1185102737 22:48850346-48850368 TGAGGAGGAGGGAGGTGAAGAGG + Intronic
1185123868 22:48993121-48993143 AGAGGAGGAGGGGGATGCAGAGG - Intergenic
1203298464 22_KI270736v1_random:60481-60503 TGAAGAAGGGTGGAGTGAAGTGG + Intergenic
1203300220 22_KI270736v1_random:71967-71989 TGTGGTGGAGTGGAATGAAGAGG + Intergenic
1203300750 22_KI270736v1_random:75389-75411 TGGAGAGGGGTGGAATGAAATGG + Intergenic
1203305571 22_KI270736v1_random:106682-106704 TGAAGTGGGGTGGAATGGAGTGG + Intergenic
1203307334 22_KI270736v1_random:118466-118488 TGGAGAGGAGTGGAATGAAGCGG + Intergenic
949923489 3:9022543-9022565 TGGGGAGGGGTGGGAGGAAGCGG + Intronic
950113903 3:10438267-10438289 TGAGCTGGGGTGTGCTGAAGGGG + Intronic
950384348 3:12645742-12645764 AGAGGTGGGGTGGGGTGAGGGGG + Intronic
950583611 3:13878690-13878712 TGAGGAGGGGTGGACCGCAGGGG - Intronic
950670331 3:14521910-14521932 GGAGGAGGGGACGGGTGAAGGGG + Intronic
951168727 3:19513035-19513057 GGAGGAGGAGGGGGAGGAAGAGG + Exonic
951363394 3:21751229-21751251 TGGGGTGGGGTGGGGTGGAGGGG - Exonic
951698458 3:25469956-25469978 GGAGGAGGGGTGGGAGCATGTGG + Intronic
952063725 3:29541944-29541966 TTAGCTGGGGTGGGATGAGGAGG - Intronic
952648011 3:35685373-35685395 TGAGGAGTGGTGGGAGCAGGGGG + Intronic
952773716 3:37024701-37024723 TGAGGAGGGAGGAGATGGAGAGG - Intronic
952855164 3:37764307-37764329 TGAGGAGGGGTTGGATGAAGAGG - Intronic
952893217 3:38058258-38058280 TGTTGAGGGATGGGATGAAGGGG + Intronic
952955836 3:38556635-38556657 TGGGGAGGGGTGGGGAGCAGAGG + Intronic
953341007 3:42134200-42134222 AGAGGAGGGGAGGGGGGAAGGGG - Intronic
953576538 3:44117294-44117316 TGGGCAGGGGTGGGGTGAGGTGG - Intergenic
953934382 3:47027406-47027428 TGTTGTGGGGTGGGTTGAAGTGG + Intronic
953998318 3:47537112-47537134 TGAGGTGGGGTTGGGAGAAGAGG + Intergenic
953998847 3:47540744-47540766 TGATGAGGGGTGGGGTGGTGGGG - Intergenic
954136106 3:48582906-48582928 TGAGGAGGGGTGAGGAGCAGGGG + Intronic
954380351 3:50215865-50215887 TGAGGAGGGGTGGGGTGGGGTGG + Intronic
955037340 3:55281963-55281985 GGAGGAGGTGTGTGCTGAAGAGG + Intergenic
955059839 3:55485172-55485194 GGAGCAGGGGTGGGAGGGAGAGG + Intronic
955238482 3:57160505-57160527 TGAGGAGGCCTGGAGTGAAGAGG - Intronic
955506778 3:59640398-59640420 TGATGAAGGCTGGGAGGAAGAGG + Intergenic
955762869 3:62306865-62306887 TGTCGAGGGGTGGGAGGAAAAGG + Intergenic
955794541 3:62621986-62622008 GGAGGATGGGTGGGATGAGTGGG - Intronic
956151300 3:66245964-66245986 TGGGGAGGGTTGGGGTGAAATGG - Intronic
956172266 3:66442440-66442462 TGAGGAGGGGGAGGAGGAGGAGG + Intronic
956522975 3:70125944-70125966 TGAGGAGATGTGGGTGGAAGAGG + Intergenic
956699172 3:71943753-71943775 TGAGGAGGAGGGGGAAGAGGAGG + Intergenic
956854142 3:73259336-73259358 TGAGGAGGAGTGGGATTAACTGG + Intergenic
956927602 3:74005917-74005939 ACAGGATTGGTGGGATGAAGAGG - Intergenic
957013119 3:75030666-75030688 TGAGGTGAGTTTGGATGAAGAGG + Intergenic
957179766 3:76861459-76861481 GGAGGAGGAGTGAGAGGAAGAGG - Intronic
957218660 3:77353950-77353972 GGAGCAGTGGTGGGAAGAAGCGG - Intronic
957338653 3:78864138-78864160 TTAGGAGGAGAGGGATGAATAGG - Intronic
957703480 3:83749054-83749076 TGTTGTGGGGTGGGAGGAAGGGG + Intergenic
958066935 3:88555864-88555886 TGTTGTGGGGTGGGAGGAAGGGG - Intergenic
958262238 3:91395170-91395192 TGTGGTGGGGTGGGAGGAGGGGG + Intergenic
958993149 3:100871011-100871033 TTATGAGGGATGGGATGGAGAGG + Intronic
959818027 3:110699020-110699042 TGAGGAGGAGGAGGAAGAAGAGG + Intergenic
959933529 3:112007394-112007416 TGAGGGTGGGAGGGATGAAAAGG - Intronic
960336457 3:116423538-116423560 TTAGGAGGTGGGGGATGGAGGGG - Intronic
960624369 3:119666122-119666144 TAAGCAGGGGTGGGATGAAGGGG + Intronic
961050445 3:123740990-123741012 AGGGGTGGGGTGGGAGGAAGAGG + Intronic
961112851 3:124299480-124299502 GGAGGTGGGGTGGGATGCAGTGG + Intronic
961200152 3:125039000-125039022 TGAGGAGGGTTGGTGTGAATGGG - Intronic
961236941 3:125375250-125375272 GGAGGAGGAGGGGGAGGAAGAGG - Exonic
961345485 3:126260786-126260808 GGAGGAGGGGGGAGAAGAAGGGG - Intergenic
961442549 3:126961525-126961547 CGAGGAGGGGTGGGGTGCACTGG + Intergenic
961539172 3:127588984-127589006 TGAGAAGGGGTGGTGAGAAGGGG + Intronic
961678318 3:128582009-128582031 GGGGGAGGGGTGGGAGGAAGGGG - Intergenic
962025121 3:131539700-131539722 TGGGGAGGTGGGGGATGCAGAGG + Intronic
962493444 3:135916312-135916334 TCGGGTGGGGTGGGAGGAAGAGG - Intergenic
962768714 3:138593034-138593056 TCAGGAGAGGTGACATGAAGGGG + Intronic
962912918 3:139871286-139871308 TGGGGAGGGGGGAAATGAAGAGG - Intergenic
963130013 3:141849240-141849262 GGAGGAGGGAAGGGTTGAAGAGG + Intergenic
963755624 3:149232392-149232414 TGTGGTGGGGTGGGAGGAGGGGG - Intergenic
964573994 3:158144280-158144302 TGTTGAGGGGTGGGAGGAGGGGG - Intronic
964850212 3:161087971-161087993 TGAGGAAGGGTGGGCTGAGGAGG + Intronic
965020356 3:163221002-163221024 TGAGGAGGAGGAGGAAGAAGAGG + Intergenic
965172180 3:165279913-165279935 GGAGGAGGGGGAGGAAGAAGAGG - Intergenic
966060552 3:175749231-175749253 GGAGGAGGGGGAGGATGATGGGG + Intronic
966099642 3:176251136-176251158 AGAGGAGGGGAGGGAGAAAGAGG + Intergenic
966355576 3:179074915-179074937 TGGGGTGGGGTTGGGTGAAGTGG - Intergenic
966642207 3:182203907-182203929 TGAGGGGAGGTGAGATGGAGAGG - Intergenic
966908471 3:184544489-184544511 GGAGGAGGGGGAGGAGGAAGAGG - Intronic
967189530 3:186973519-186973541 TGGGCAAGGGTGAGATGAAGTGG - Intronic
967281043 3:187823935-187823957 TGACTGGGGGTGGGGTGAAGAGG - Intergenic
967326875 3:188249795-188249817 AGAGGAAGGGAGGGAGGAAGGGG - Intronic
967768854 3:193312264-193312286 TGAGGAGGAGAAGGAAGAAGAGG - Intronic
967987722 3:195107590-195107612 GGAGGAGGGGGAGGAGGAAGGGG + Intronic
967987749 3:195107650-195107672 GGAGGAGGGGGAGGAGGAAGGGG + Intronic
968432416 4:566729-566751 GATGCAGGGGTGGGATGAAGGGG - Intergenic
968432427 4:566756-566778 GATGCAGGGGTGGGATGAAGGGG - Intergenic
968666177 4:1823467-1823489 TGAGGAGGGATGGAAGGAAGGGG + Intronic
968742170 4:2336807-2336829 TGAGGAGGTGTGGATTGAGGAGG + Intronic
968952041 4:3700299-3700321 GGAGGAGGAGGGGGAGGAAGTGG + Intergenic
969269854 4:6092164-6092186 TGAGGACGGCTGGGAGGGAGGGG - Intronic
969293835 4:6257518-6257540 TGAGCAGGGGTGGGAGGGTGCGG + Intergenic
969330649 4:6472015-6472037 TGGGGTGGGGTGGGATGGGGTGG + Intronic
969454881 4:7295120-7295142 GGAGGAGGGGGAGGAGGAAGAGG - Intronic
969573376 4:8023063-8023085 AGAGGAGGGGGAGGAGGAAGAGG - Intronic
969823803 4:9740759-9740781 GGAAGAGGGGGGGGATGATGGGG + Intergenic
969850401 4:9952105-9952127 TGAGGAGTAGAGGGGTGAAGTGG - Intronic
969982107 4:11168317-11168339 TGTGGTGGGGTGGGGAGAAGGGG - Intergenic
970277710 4:14419861-14419883 TGAGCAGGAGAGGGAAGAAGAGG - Intergenic
970601989 4:17647866-17647888 TGGGGTGGGGTTGGATGACGTGG + Intronic
971034151 4:22675088-22675110 GGAGGAAGGGAGGGAGGAAGGGG - Intergenic
971208815 4:24596507-24596529 TAATGAGGGATGGGAGGAAGTGG + Intergenic
971287186 4:25302148-25302170 GGAGGAGGGGTGGGATGAGGTGG - Intergenic
971357654 4:25909440-25909462 TGAGGAGGAGTAGGAGCAAGTGG + Intronic
971784620 4:31084707-31084729 GGAGGAGGGGAGGGGAGAAGAGG + Intronic
971804575 4:31339258-31339280 GGAGGAGGGGTGAGATGGGGTGG - Intergenic
972575693 4:40349245-40349267 TGAGGACGCATGGGATGAGGAGG - Exonic
972689581 4:41383410-41383432 TGAGGAGCGAAGTGATGAAGGGG + Intronic
972699305 4:41478723-41478745 TGAGGATGGGAAGGAAGAAGGGG - Intronic
973265961 4:48210521-48210543 TGAGGAGGAGGAGGAGGAAGAGG + Intronic
973629863 4:52810365-52810387 TGGGGAGGGGTGGCATGAGATGG + Intergenic
973682464 4:53334596-53334618 TGTGGTGGGGTGGGGGGAAGGGG + Intronic
973790109 4:54370521-54370543 AGAGGATGGGAGAGATGAAGGGG - Intergenic
973791204 4:54379757-54379779 TTAGGTGGGGTGGGAGGCAGGGG - Intergenic
974949878 4:68575262-68575284 TGAGGGGGGGTGGGGGGAAGGGG + Intronic
975043906 4:69778904-69778926 AGGGGAAGGGAGGGATGAAGGGG + Intronic
975101847 4:70522549-70522571 CCAGGAGGGGTGGGATGGTGTGG - Intronic
975252148 4:72192865-72192887 TGGGGTGGGGTGGGGTGGAGAGG + Intergenic
975497792 4:75053849-75053871 TGAGGAGGGCTGGAAGGATGGGG - Intergenic
975848879 4:78551721-78551743 GGAGGAGGGGCAGGAGGAAGGGG + Exonic
975991310 4:80262752-80262774 TGGGTAGGGGTGGGGTGCAGAGG + Intergenic
976032781 4:80777319-80777341 TCAGGAGGTGTGGGATGCAGGGG - Intronic
976690767 4:87864713-87864735 TTTGGGGGGGTGGGAGGAAGAGG - Intergenic
976775156 4:88698880-88698902 TAAGGAGGGTGGGGAAGAAGAGG - Intronic
976775164 4:88698904-88698926 TGAGGAAGGTGGGGAAGAAGAGG - Intronic
976863260 4:89691529-89691551 TGGGGAGGGGAGGGAAAAAGAGG + Intergenic
976969377 4:91086009-91086031 AGAAGAGGGGTGGGAAAAAGAGG + Intronic
977294045 4:95192269-95192291 TGAGAAGAGGTGGGCAGAAGAGG - Intronic
977559012 4:98513541-98513563 TCAGTGGGGGTGGGAGGAAGGGG + Intronic
977836240 4:101648635-101648657 TGGGGTGAGGTGGGAAGAAGGGG + Intronic
978156820 4:105499213-105499235 TGTGGTGGGGTGGGGGGAAGGGG - Intergenic
978599373 4:110411772-110411794 TGAGGAAGGGTGGAAAGCAGAGG + Intronic
978718331 4:111873630-111873652 TGAGGTGGGGTGGGATAGAGTGG - Intergenic
978816093 4:112907485-112907507 TGAGGAGGAGGGGAAAGAAGAGG - Intronic
979564268 4:122136512-122136534 TGAGGAAGGGGAGGAAGAAGAGG - Intergenic
979748166 4:124243024-124243046 TGATGAGGGCTTGGAAGAAGAGG + Intergenic
980283067 4:130745991-130746013 TGAGGAGGCGGATGATGAAGAGG - Intergenic
980682215 4:136177941-136177963 TGAATGGGGGTGGGATGAAGTGG + Intergenic
982071837 4:151702352-151702374 AGAGGGAGGGAGGGATGAAGAGG + Intronic
982096179 4:151925624-151925646 TGAGGAGGGATTGGATGATTGGG - Intergenic
982111540 4:152060976-152060998 TGAGGAGGAGGAGGAAGAAGAGG + Intergenic
982114270 4:152084328-152084350 TGAGGAGGAGAGGGAAGAAGAGG + Intergenic
982821402 4:159944477-159944499 TGAGGAGAAGTAGGAGGAAGAGG - Intergenic
982943904 4:161593568-161593590 TGAGGAGGGGGAGGGAGAAGGGG + Intronic
983161969 4:164427722-164427744 ATAGGAGGAGGGGGATGAAGAGG + Intergenic
983735024 4:171046482-171046504 TGAAGAGAGCTGGGATGAGGAGG + Intergenic
983784032 4:171709828-171709850 TGGGGAAGGGTGGGATAAACAGG + Intergenic
984014030 4:174405001-174405023 AGAGGAGGGGAGGGAAGATGAGG - Intergenic
984438636 4:179736844-179736866 TGTGGTGGGGTGGGAGGATGGGG - Intergenic
984943328 4:184952685-184952707 GGAGGAGGGGAGGGGTGACGTGG + Intergenic
985574128 5:665781-665803 TGAGGAGGTGTGGTCAGAAGGGG - Intronic
985841966 5:2313300-2313322 GGAGGGTGGGTGGGAAGAAGCGG - Intergenic
985874703 5:2585893-2585915 TGAGGAGGTGTGGTATGGAAGGG - Intergenic
986542126 5:8856208-8856230 TGTGGATGGGTGTGCTGAAGAGG - Intergenic
986887665 5:12259864-12259886 AGAGTAGGGGTGAGATGAACAGG - Intergenic
986917427 5:12639194-12639216 TGTGGAGGGGGGAGATCAAGTGG + Intergenic
987123238 5:14787503-14787525 TTAGGAGAAGTGGGATTAAGAGG + Intronic
987306257 5:16640587-16640609 TAGGGAGGGGAGGGATGAGGAGG + Intergenic
987763280 5:22192672-22192694 TAAGGAGGGGTGGGATAAGCTGG + Intronic
987880191 5:23734433-23734455 TGTGGTGGGGTGGGGGGAAGGGG - Intergenic
988284546 5:29194484-29194506 TGAGAAGGGGTGGGAGGAAAAGG - Intergenic
988432749 5:31138675-31138697 TAATGAGGGGTGGGGTGGAGGGG - Intergenic
988465196 5:31483761-31483783 TGAGGAGGAGTGGCAGGAGGTGG - Intronic
988680688 5:33481179-33481201 TGAGGGGAGGGGGAATGAAGGGG - Intergenic
988948664 5:36234865-36234887 TGGGAAGGGTAGGGATGAAGGGG - Intronic
989097045 5:37791363-37791385 GGAGGAGGGGTTGGAGAAAGAGG + Intergenic
989349212 5:40465790-40465812 TCTGGAAAGGTGGGATGAAGTGG - Intergenic
989429240 5:41332939-41332961 TGTTGTGGGGTGGGAGGAAGAGG + Intronic
989444212 5:41509624-41509646 AGCGGAGGGGTGGGATTAATAGG - Intronic
989445418 5:41522843-41522865 GGAGGATGGGTGGGAGGAATTGG - Intergenic
989573614 5:42968552-42968574 TGTTGTGGGGTGGGAGGAAGGGG + Intergenic
989983971 5:50674390-50674412 TGACATGGGATGGGATGAAGAGG - Intronic
990123435 5:52484378-52484400 TGAGGAGGGGAGAAAGGAAGGGG + Intergenic
990253161 5:53937842-53937864 TGGAGTGGGGTGGGGTGAAGTGG + Intronic
990997841 5:61751023-61751045 TGAGGAGGAGAAGGAAGAAGAGG + Intronic
991898000 5:71425756-71425778 TAAGGAGGGGTGGGATAAGCTGG + Intergenic
991935912 5:71799955-71799977 TGTTGAGGGGTGGGGTCAAGGGG + Intergenic
992013926 5:72557187-72557209 TGAGCAGGGGTGGGGTGAGGTGG + Intergenic
992183939 5:74225753-74225775 AGAGGAAGGGAGGGAGGAAGGGG - Intergenic
992357192 5:75998186-75998208 TGATACGGGGTGGGAGGAAGGGG + Intergenic
992435376 5:76750995-76751017 AGAGGAGGGATGGGCTGGAGAGG + Intergenic
992442416 5:76808517-76808539 TGAGAAGGGGTGGTAAGGAGAGG - Intergenic
992855345 5:80855194-80855216 TAAGGAGAGGTGCCATGAAGGGG - Intronic
993076767 5:83241931-83241953 TGAGGAAGAGTGGGAGGAGGAGG + Intronic
993464185 5:88224768-88224790 TGAGGAGGAGAAGGAAGAAGAGG - Intronic
993703179 5:91142582-91142604 TGGGGTGGGGTGGGAAGAAGTGG - Intronic
994177850 5:96731648-96731670 TGTGGAGGGGTGGGGAGAGGGGG - Intronic
994825398 5:104707648-104707670 TGAGGAGGAGGAGGAGGAAGAGG + Intergenic
995358447 5:111266317-111266339 TGAAAAGGGCTGGGTTGAAGAGG - Intronic
995608984 5:113889313-113889335 AGGGGAGGGGAGGGAAGAAGAGG - Intergenic
996008032 5:118447053-118447075 GGGGAAGGGGTGAGATGAAGTGG + Intergenic
996040111 5:118800001-118800023 TGAGGTGAGGTGGGTTGATGTGG - Intergenic
996698116 5:126421407-126421429 TGAGGAGGGTGGGGATCTAGAGG + Intronic
996753447 5:126912226-126912248 TTAGGAACGGTGGCATGAAGGGG + Intronic
996921218 5:128769840-128769862 TGGGGTGGGGTGAGATGAAAAGG + Intronic
997507849 5:134432505-134432527 TGGGTTGGGGTGGGGTGAAGGGG + Intergenic
997676236 5:135715122-135715144 TGAGGAGGTGAGGGCTGAACTGG + Intergenic
998454867 5:142264087-142264109 TGTGGTGGGGTGGGGAGAAGGGG - Intergenic
998511456 5:142717850-142717872 TGTAGAGTGGTGGGATGAAGTGG + Intergenic
998765950 5:145487529-145487551 TGAGGAAGGGTTGGCTGGAGGGG + Intronic
999044838 5:148455920-148455942 TGAGGAGGAGGAGGATGAAGAGG + Intronic
999095948 5:148978459-148978481 GGAGGAGGAGAGGTATGAAGGGG - Intronic
999228272 5:150045603-150045625 TCATGAGTGGTGGGAAGAAGGGG - Exonic
999258329 5:150222326-150222348 GAAGGAGGGGTGGCATGATGAGG - Intronic
999407202 5:151316990-151317012 CCAGGAGCGGTGGGATGATGAGG + Exonic
999409737 5:151340236-151340258 GGAGGAGGAGGGGGAAGAAGAGG + Intronic
999425955 5:151488059-151488081 CCAGGAGCGGTGGGATGATGAGG - Exonic
999723174 5:154413583-154413605 GCAGGATGGGTGGGATGCAGAGG + Intronic
999732792 5:154487867-154487889 TGAGGCAGGGTGGGATGGTGGGG - Intergenic
1000009381 5:157217415-157217437 TGAGGAGGGGGTGGCTGAGGTGG - Intronic
1000045427 5:157518303-157518325 TGTGGAGGTGGGGGAGGAAGGGG + Intronic
1000361650 5:160453229-160453251 AGATGAGGAGTGGGCTGAAGTGG - Intergenic
1000631678 5:163597547-163597569 TGAGTAGGTTTGGGATGAACTGG + Intergenic
1001066335 5:168537760-168537782 TGAGGAGGGTGAGGAGGAAGGGG + Intergenic
1001248857 5:170129461-170129483 TGAGGAGGGTTGGAAGGATGTGG + Intergenic
1001344739 5:170883596-170883618 TGGGGGAGGGTGGGATGAATAGG - Intronic
1001503139 5:172254908-172254930 TGAGGAGGAGGAGGAGGAAGAGG - Intronic
1001719180 5:173842472-173842494 TGAGGAGGGGGAGGAAGAGGAGG + Intergenic
1001763513 5:174226499-174226521 TCAGGATGAGTGGAATGAAGAGG + Intronic
1001940629 5:175737105-175737127 AGGGAAGGGGTGGGAGGAAGAGG + Intergenic
1001959352 5:175871167-175871189 TGAGGAGTGGTGGGGGCAAGGGG - Intronic
1002469186 5:179424773-179424795 AGAGCTGGGGTGGGATGGAGAGG + Intergenic
1002874774 6:1201395-1201417 TGAGGAGGGGCTGGCTGGAGCGG - Intergenic
1002886991 6:1306271-1306293 CAAGGAGGGGAGGGAAGAAGGGG - Intergenic
1002922025 6:1579778-1579800 TGAGGAGGGGTGAAATGAGGGGG - Intergenic
1003182971 6:3807699-3807721 GGAGGAGGTGTGGGAGGAGGTGG - Intergenic
1003254168 6:4459837-4459859 TGAGGAGGGCTGGGAAGAGGAGG + Intergenic
1003509934 6:6771301-6771323 GGAGGAAGGGAGGGAGGAAGAGG + Intergenic
1003509945 6:6771344-6771366 GGAGGAAGGGAGGGAGGAAGAGG + Intergenic
1003509956 6:6771387-6771409 GGAGGAAGGGAGGGAGGAAGAGG + Intergenic
1003549183 6:7086609-7086631 TGAGGAAGGCTGGGCTGACGGGG - Intergenic
1004005896 6:11637065-11637087 TGAGGAGGGGTTGGGAGAAGGGG - Intergenic
1004271645 6:14201253-14201275 TCAGGAGGGGTTGGATCCAGTGG + Intergenic
1004278491 6:14258857-14258879 TGGGGAGGGGGAGGAGGAAGAGG + Intergenic
1004637823 6:17485874-17485896 TGAGGAGGGGAAGGATGGAATGG + Intronic
1005360959 6:25030328-25030350 TGAGGTGGAGTGGGATTCAGAGG + Intronic
1005744658 6:28825237-28825259 AGAGGCGGGGTGCGGTGAAGTGG + Intergenic
1005805937 6:29474519-29474541 TGTTGTGGGGTGGGGTGAAGGGG + Intergenic
1006087111 6:31603907-31603929 CCAGCAGTGGTGGGATGAAGGGG - Intergenic
1006174386 6:32113246-32113268 AGAGGAAGGGAGGGATGATGAGG + Intronic
1006385686 6:33729540-33729562 TGAAGAGGGGTGGGAACCAGTGG - Intronic
1006448354 6:34092207-34092229 TGGGGAGGGGTGGGCTGTGGTGG - Intronic
1006525022 6:34596940-34596962 TGATGAAGGGTTGGATGAATGGG - Intronic
1006610462 6:35291516-35291538 TGAGGAGGGGTGTGGGAAAGAGG - Intronic
1007186661 6:39977688-39977710 AGAGGAGGAGTGGTAGGAAGTGG - Intergenic
1007615813 6:43179388-43179410 GGAGGTGGGGCGGGAAGAAGGGG - Exonic
1008342324 6:50382553-50382575 TGGGGTGGGGTGGGGTGATGAGG - Intergenic
1008532654 6:52478270-52478292 TGTGGTGGGGTGGGAGGAGGGGG + Intronic
1008546499 6:52588397-52588419 TGACTAGGGGTGGGAAAAAGAGG + Intergenic
1008800536 6:55363583-55363605 TGAGGTGGGGTGGGGGGAGGGGG - Intronic
1009390625 6:63139562-63139584 TGTGAAGCGGTGTGATGAAGTGG + Intergenic
1011173123 6:84528632-84528654 AGAGGAGGGGAAGGATGAAAAGG + Intergenic
1011476374 6:87752796-87752818 TGAGGAGAGGTGGGATAAAATGG - Intergenic
1011516994 6:88166060-88166082 CGAGGCGGGGTGGGGTGGAGTGG + Exonic
1011749239 6:90438746-90438768 TGAGGTGGGGTAGGATGCACTGG - Intergenic
1011904026 6:92338251-92338273 TGAGGGGGAGTGGGAGGATGAGG + Intergenic
1012914942 6:105159874-105159896 TGGGGAGGGGTGGGGGGTAGAGG + Intronic
1013266878 6:108508488-108508510 TGAGAAGAGATGGGAGGAAGGGG + Intronic
1013282978 6:108656114-108656136 TGAGGTGGGGTGGGGTGGGGTGG - Intronic
1013346540 6:109265839-109265861 AGAGCAGGGGTGGAATGAGGGGG + Intergenic
1013582035 6:111545306-111545328 TGAAGAGGGGTGGCTTGATGTGG - Intergenic
1013656855 6:112254988-112255010 TGAGGACTGGAGGGAGGAAGAGG - Intergenic
1014255427 6:119156337-119156359 TGACGTGGGGTGGGAGGAGGGGG + Intergenic
1014838925 6:126194119-126194141 TGAAGAGAAGTTGGATGAAGTGG + Intergenic
1014925509 6:127266419-127266441 TGGGGAGGGGGGGGACGGAGGGG - Intergenic
1015076333 6:129162887-129162909 CTAGGAGGGGGGGGAAGAAGAGG + Intronic
1015167664 6:130216240-130216262 TGGAGAGGGGTGGGGTGGAGGGG + Intronic
1015168117 6:130221692-130221714 TGAGGAGGAGGAGGAGGAAGAGG + Intronic
1015553874 6:134440900-134440922 TGGGGTGGGGTGGGATGTGGGGG - Intergenic
1016984202 6:149882240-149882262 TGAGGAGGGGAGAGATGGAGGGG + Intergenic
1017219009 6:151944231-151944253 TGGGGAGGGCAGGGGTGAAGTGG + Exonic
1017462943 6:154668296-154668318 AGAGGAGGAGTGGGAGGAGGAGG + Intergenic
1017488216 6:154921999-154922021 TGAGGTGGGGTGGGAAGAGGGGG + Intronic
1017597070 6:156039997-156040019 TGTGGTGGGGTGGGGGGAAGGGG + Intergenic
1017624925 6:156338609-156338631 AGAGGAAGGGAGGGAGGAAGGGG - Intergenic
1018011700 6:159676592-159676614 TGTCGAGGGGTGGGGAGAAGGGG + Exonic
1018063788 6:160111330-160111352 TGAGGAGGAGGAGGAGGAAGTGG - Intronic
1018250664 6:161866785-161866807 TGAGTAGGTGTGGGAGGATGTGG + Intronic
1018429905 6:163714140-163714162 TGAGGTGGTGTGGGCTGAGGAGG + Intergenic
1018453627 6:163932189-163932211 TGTGGAGGGCTGGGAAGAGGAGG - Intergenic
1018737555 6:166698948-166698970 TGAGGAGGCGAGGAACGAAGAGG + Intronic
1018744131 6:166749647-166749669 TGAGGAGGTGGGGGCTCAAGGGG - Intronic
1018840575 6:167513848-167513870 AGAGCAGGGGTGGGAGGGAGAGG + Intergenic
1018844707 6:167547503-167547525 GGAGGAGGGATGGGGTGAAGAGG - Intergenic
1018866027 6:167747723-167747745 GGAGGAGGGGAGAGAGGAAGAGG + Intergenic
1019508354 7:1404800-1404822 GGAGGAGGGGAGGGAGGAGGGGG + Intergenic
1019508369 7:1404834-1404856 GGAGGAGGGGAGGGAGGAGGGGG + Intergenic
1019508384 7:1404868-1404890 GGAGGAGGGGAGGGAGGAGGGGG + Intergenic
1019508399 7:1404902-1404924 GGAGGAGGGGAGGGAGGAGGGGG + Intergenic
1019551711 7:1606613-1606635 GGAGGAGGAGTGGGAGGAGGGGG - Intergenic
1019551830 7:1606913-1606935 GGAGGAGGGGTAGGAGGAGGGGG - Intergenic
1019904210 7:4048473-4048495 GGACGAGGGGTGGGGGGAAGCGG - Intronic
1020133171 7:5570764-5570786 TGGGGAGGAGTGGGATGTAGAGG - Intergenic
1020283476 7:6663616-6663638 TGTGGAGGTGGGGGGTGAAGGGG + Intergenic
1020283524 7:6663737-6663759 TGTGGAGGTGGGGGGTGAAGGGG + Intergenic
1020595442 7:10202474-10202496 GGGGGAAGGGTGGGAGGAAGAGG + Intergenic
1020792990 7:12649054-12649076 TGAGGAGTGGTGATATGAGGGGG + Intronic
1021622448 7:22562219-22562241 GGAGGAGGAGGGGGAGGAAGAGG - Intronic
1021622456 7:22562240-22562262 GGAGGAGGGGGAGGAGGAAGAGG - Intronic
1022042267 7:26592256-26592278 CTAAAAGGGGTGGGATGAAGGGG + Intergenic
1022082969 7:27042449-27042471 TGCGGAGGGGTGAGAAGAATGGG - Intergenic
1022233982 7:28443710-28443732 TGAGGAGGAGAGGGGTTAAGTGG - Intronic
1022388583 7:29924396-29924418 TGAGGAGTGGGGAGATGCAGGGG - Intronic
1022474282 7:30699982-30700004 GGAGGAGGTGTGGGACGTAGAGG + Exonic
1022703953 7:32785935-32785957 TGAGGCAGGGAGAGATGAAGGGG + Intergenic
1022902494 7:34824907-34824929 AGAAGCAGGGTGGGATGAAGAGG - Intronic
1023139216 7:37084169-37084191 TGAGGAGGAGCGGGAGGGAGAGG + Intronic
1023145701 7:37148826-37148848 TGACGAGAGGTGGGAGAAAGGGG - Intronic
1023353086 7:39339785-39339807 TGGGGTGGGGTGGGCTGCAGCGG - Exonic
1023752270 7:43384005-43384027 TGAGGAGGAGGAGGAGGAAGAGG + Intronic
1023852653 7:44158866-44158888 TGAGGAGGGGTGGTGGGCAGAGG + Intronic
1023963005 7:44943272-44943294 AGAAGAGGGGAGGGATGAATAGG + Intergenic
1024353972 7:48395604-48395626 TGAGGAGGAGGAGGAGGAAGGGG - Intronic
1024607458 7:51034172-51034194 GGAGCAGAGGTGGGATGCAGAGG - Intronic
1024663955 7:51527347-51527369 AGAGGTGGGGGTGGATGAAGGGG + Intergenic
1024717519 7:52096764-52096786 GGAGGAAGGGAGGGATGAATGGG + Intergenic
1024772407 7:52738717-52738739 GGAGGAAGGGAGGGATGAATAGG - Intergenic
1024924362 7:54597681-54597703 GGAGGAGGTGTGGAATGAGGAGG + Intergenic
1024962905 7:54996239-54996261 TGAGGTGGAGGAGGATGAAGTGG - Intergenic
1024977325 7:55125940-55125962 TGAGGGGAAGTGGGATGGAGAGG - Intronic
1025026901 7:55523828-55523850 GGAGGGTGGGTGGGGTGAAGTGG + Intronic
1025056156 7:55766955-55766977 TGTGGTGGTGTGGGATGCAGTGG - Intergenic
1025084218 7:56009547-56009569 TGGGGTGGGGTGGGGTGAGGTGG - Intergenic
1025154388 7:56590657-56590679 TGTGGTGGGGTGGGGGGAAGGGG + Intergenic
1025198771 7:56949633-56949655 GGAGAAGGGGTGGGAGGAGGAGG - Intergenic
1025673175 7:63627300-63627322 GGAGAAGGGGTGGGAGGAGGAGG + Intergenic
1025916038 7:65866865-65866887 AGAGGAGGAGGGGGAAGAAGAGG + Intergenic
1027197580 7:76041351-76041373 TGTGTAGGGGTGGGGTGAGGAGG + Intronic
1027198432 7:76047614-76047636 TTAGGCGGGGTGGGAGGAAGGGG - Intronic
1027219522 7:76205003-76205025 TGAGGAGAGAGGGGATCAAGAGG - Intronic
1027275965 7:76556406-76556428 TGAGGAGGGGAAGGAAGATGGGG - Intergenic
1027753830 7:82185523-82185545 GGAGGAGGAGGGGGAGGAAGGGG + Intronic
1028101920 7:86831195-86831217 TGAGGAAGGGTGGAATGATAGGG + Intronic
1028585062 7:92444557-92444579 TGAAGATGAGTGGGATGAGGAGG + Intergenic
1028810808 7:95083446-95083468 TGAGGAGGGGAAGGTTCAAGTGG + Intronic
1029131693 7:98336141-98336163 TGAGGGGGGGTGGGAGAGAGGGG + Intronic
1029235384 7:99111950-99111972 GGAGGAGAGGTGGGGTGTAGGGG + Intronic
1029873663 7:103723687-103723709 TGTGGAGGGGTGTGATGAAATGG + Intronic
1029877698 7:103771367-103771389 TGGGCAGGAGTGGGAAGAAGAGG - Intronic
1030124275 7:106139734-106139756 TGAGGAGGCCTGGGCTGGAGAGG + Intergenic
1030348435 7:108457441-108457463 TGAGGTGGGGTGGGGTGGTGAGG - Intergenic
1030736751 7:113058067-113058089 TAAGGAGAGCTAGGATGAAGTGG - Intergenic
1030910394 7:115241139-115241161 AGAGGAAGGGAGGAATGAAGAGG - Intergenic
1031071942 7:117171466-117171488 TGAGAAGAGCTGGGATGAAGCGG - Intronic
1031701487 7:124931611-124931633 GGGGCAGGGGTGGGATGGAGGGG - Intergenic
1032089724 7:128905407-128905429 TGAAGAGAGCTGGGAGGAAGAGG - Intronic
1032092523 7:128918124-128918146 TGAAGAGAGCTGGGAGGAAGAGG + Intergenic
1032523798 7:132564168-132564190 AGAGGAGGGGCAGGAGGAAGAGG - Intronic
1032559416 7:132873114-132873136 TGAAGAGGGGGAGGATGAAAAGG + Intronic
1032655105 7:133919524-133919546 TGAGGGAGGGAGGGATGAATAGG - Intronic
1033139553 7:138813114-138813136 TGAGCAGGTGTGCTATGAAGTGG - Intronic
1033165208 7:139034201-139034223 AGAAGAGGGATGGGAAGAAGGGG - Intronic
1033609065 7:142948070-142948092 TGAGAAGGGGTGAGAAGAATAGG - Intronic
1034436411 7:151064671-151064693 TGAGGAGGGGGAGGAAGATGAGG + Exonic
1034474772 7:151275992-151276014 TGAGCAGGGTTGGGAGGAAAGGG + Intronic
1034720757 7:153290145-153290167 GGAGGAGGAGTGGGAAGAGGAGG + Intergenic
1035043554 7:155948656-155948678 TGAGCAGGTGTGGGGTCAAGAGG + Intergenic
1035266963 7:157694407-157694429 GGAGGGGTGGTGGGAGGAAGGGG - Intronic
1035280683 7:157776306-157776328 GGAGGAGGAGAGGGAGGAAGAGG - Intronic
1035280801 7:157776776-157776798 GGAGGAGGAGAGGGAGGAAGAGG - Intronic
1035882522 8:3257755-3257777 TGAGAAGGGGGTGGATGATGAGG + Intronic
1035995608 8:4543291-4543313 GGAGGAAGGGAGGGATGAACAGG - Intronic
1036438453 8:8758285-8758307 TGAGGATGGGTGGGAAGGAAAGG - Intergenic
1036497630 8:9283853-9283875 TGGGGTGGGGTGGGAGGGAGAGG - Intergenic
1036526220 8:9537298-9537320 TGGGGAGGGGTGGGGGGATGTGG - Intergenic
1036845126 8:12162572-12162594 TGAGGAGGAGTTGAATCAAGTGG + Intergenic
1036866495 8:12404895-12404917 TGAGGAGGAGTTGAATCAAGTGG + Intergenic
1037300278 8:17444113-17444135 AGTGGAGGGGCGGGAGGAAGAGG - Intergenic
1037497003 8:19450087-19450109 GGAGGAGGGGGAGGAGGAAGGGG + Intronic
1037583699 8:20261966-20261988 GGAGGAGGTGTGGGACGGAGAGG - Intronic
1037601018 8:20394034-20394056 TGGACAGGGGTGGGAGGAAGTGG + Intergenic
1038112366 8:24513660-24513682 TGAGGAGGCTAGGGATTAAGAGG + Intronic
1038339536 8:26673909-26673931 GGAGGAGGGGAGGGAGGAGGAGG - Intergenic
1038883527 8:31639797-31639819 GGAGGAGGAGGGGGAAGAAGTGG - Intronic
1039455354 8:37702351-37702373 GGAGGAGGGCTGGGAAGAGGAGG - Intergenic
1039473814 8:37829036-37829058 TGTGGGGGGGTGAGAGGAAGGGG - Intronic
1039575332 8:38619145-38619167 TGGGGGGGGGTGGGATGAGATGG - Intergenic
1039599938 8:38827857-38827879 TGGCGAGAGGTGGGAGGAAGAGG + Intronic
1040079759 8:43274869-43274891 GGAGGAGGAGTGAGAGGAAGAGG - Intergenic
1040079801 8:43275001-43275023 GGAGGAGGAGGGGGAGGAAGAGG - Intergenic
1040413537 8:47178771-47178793 TGAGGAGGCGTGGTGAGAAGGGG - Intergenic
1041525817 8:58804364-58804386 TGAGGAGGAGGAGGAAGAAGGGG - Intergenic
1041835804 8:62213720-62213742 TGAGGAGGAGTAAGAAGAAGAGG + Intergenic
1042270325 8:66949250-66949272 TGTGGTGGGGTGGGAGGAGGGGG - Intronic
1042311043 8:67379786-67379808 TGGGGAGGGGAAGGAGGAAGGGG - Intergenic
1042333504 8:67607135-67607157 AGAGGAGGGGGGGGAGGAGGGGG - Intronic
1042612880 8:70617418-70617440 TAAGGAGGGGAGAGATGAACAGG + Intronic
1042667322 8:71221306-71221328 TGAGGTGGGGTGGGATGGGGCGG + Intronic
1043224449 8:77706425-77706447 TGAGGAGGAGGAGGAGGAAGAGG + Intergenic
1043286002 8:78532373-78532395 TGAGCAGGGGTGAGCTGGAGTGG - Intronic
1043687663 8:83107543-83107565 TTAGGAAGGGTAGGAAGAAGTGG + Intergenic
1043726216 8:83614265-83614287 GGAGGAAGGGAGGGAGGAAGGGG - Intergenic
1044584388 8:93856076-93856098 TGAGGCAGGGTGGGAGGAACTGG - Intergenic
1044613619 8:94118164-94118186 TGGTGAGGTGGGGGATGAAGGGG + Intergenic
1044698771 8:94948775-94948797 TGAGGAGGGGTGAGAGGAGGAGG + Intronic
1044818965 8:96143372-96143394 TGGGGAAGGGAGGGATGAAAGGG - Exonic
1045635477 8:104182537-104182559 TGAGGGGAGGAGGGATGAATGGG - Intronic
1045957453 8:107925550-107925572 TGATGTGGGGTGGGAGGAGGGGG - Intronic
1046000128 8:108410435-108410457 TGAGGAGGGGGAGGAAGAGGTGG + Intronic
1046009946 8:108534244-108534266 TGAGGAGGGGTATGGAGAAGGGG - Intergenic
1046383810 8:113483784-113483806 TGGGTGGGGGTGGGAGGAAGTGG - Intergenic
1046658886 8:116927133-116927155 TGAGTAGGGGCGGGAAGAATGGG + Intergenic
1046904540 8:119558408-119558430 GGAGGAGAGGAGGGAAGAAGCGG + Intronic
1047018236 8:120746173-120746195 TGAGGAGGAGGAGGAAGAAGAGG - Intronic
1047483431 8:125306459-125306481 TGGGGAAGGGAGGGAGGAAGTGG - Intronic
1047739500 8:127795127-127795149 TGAGGGGGTGTGAGAGGAAGCGG - Intergenic
1048007615 8:130431955-130431977 GGAGGAGGAGGGGGAAGAAGGGG + Intronic
1048025910 8:130586435-130586457 TGAGGAAGGGTGGGAAGATGAGG + Intergenic
1048194659 8:132322458-132322480 TCAGGAGGTGTGGGGTGGAGAGG - Intronic
1048408804 8:134150594-134150616 TGTGTGGGGGTGGGAGGAAGGGG - Intergenic
1048480084 8:134781748-134781770 TGAGGAGGGGGAGGAAGAGGGGG - Intergenic
1048900304 8:139031351-139031373 TGAGTAGGGGTGGGCTGGAGCGG + Intergenic
1049018907 8:139940740-139940762 TGAGGTGGGGAAGGAGGAAGAGG - Intronic
1049674026 8:143881840-143881862 GGAGGAGGGGGAGGAGGAAGGGG + Intergenic
1049694279 8:143976033-143976055 TGAGGTGGGGTGGCGTGATGGGG - Intronic
1049702042 8:144019812-144019834 TGGTGAGGGCTGGGATGAGGAGG - Intronic
1050650163 9:7767295-7767317 TGTTGTGGGGTGGGAGGAAGGGG - Intergenic
1050665957 9:7936847-7936869 TGAGGAGGAGGGGGAGGAATGGG - Intergenic
1051073142 9:13197739-13197761 TGAGGAGGGGTGGGATGAAGAGG - Intronic
1051118702 9:13728208-13728230 TTAGGATGTGGGGGATGAAGAGG - Intergenic
1051349312 9:16184137-16184159 TGAGGAGGGGAGGAAGGAGGAGG + Intergenic
1051752980 9:20363540-20363562 TGAGGAGGAATCAGATGAAGTGG - Exonic
1051789509 9:20784504-20784526 GGTGGATGGGTGAGATGAAGTGG + Intronic
1052049846 9:23832056-23832078 TGAGCAGGGGTGAGAGGAAGTGG + Intergenic
1052785401 9:32823459-32823481 TGAGGAGGGGGAGGATTCAGGGG - Intergenic
1052935042 9:34085876-34085898 TGAGGAAGGGTGGTATGATTTGG + Intergenic
1053329173 9:37188515-37188537 TAAGGAGGGGTGGGGAGAGGGGG - Intronic
1053407417 9:37889456-37889478 GGTGGAGGTGTGGGATGATGGGG + Intronic
1054715280 9:68551283-68551305 GGAGGAGCGGTGGGAAGAAAAGG - Intergenic
1055415436 9:76077550-76077572 TGGGGAGGGGAGAGAGGAAGGGG - Intronic
1056315315 9:85383037-85383059 TGAGAAAGGGTGGCAGGAAGTGG - Intergenic
1056316517 9:85395562-85395584 TGAGGAGGGATGGTGTGCAGGGG + Intergenic
1056989511 9:91397648-91397670 TGAGGAGGGATTGGAGGTAGAGG - Intergenic
1057014064 9:91635036-91635058 AGAGGAGGGGGAGGAAGAAGAGG + Intronic
1057209931 9:93195059-93195081 AGAGGAAAGGAGGGATGAAGAGG + Intronic
1057497394 9:95571906-95571928 GGAGGAGGAGAGGGAGGAAGAGG + Intergenic
1057591828 9:96379671-96379693 GGAGGAGGAGTGGGTTGATGTGG - Intronic
1057598729 9:96438732-96438754 TGGGGGAGGGTGGGATGAAGAGG + Intergenic
1057677865 9:97149876-97149898 TGTGGAAGGGTGGGATGTAGTGG - Intergenic
1058102939 9:100937261-100937283 TGTGCAGAGGGGGGATGAAGTGG + Intergenic
1058568975 9:106320142-106320164 TGTGGTGGGGTGGGAGGAGGGGG + Intergenic
1058581545 9:106464077-106464099 TGAGGAGGAGGTGGAAGAAGAGG - Intergenic
1058989585 9:110242131-110242153 TGAGGATGGGAGGGAGAAAGGGG - Intergenic
1059101009 9:111471488-111471510 ATAGGAGGGGTGGGGAGAAGGGG + Intronic
1059526820 9:114999897-114999919 TGAGGAGGGGTGGGAAGCTGTGG - Intergenic
1059663094 9:116420808-116420830 TGAGGAGGAGAAGGAGGAAGAGG + Intergenic
1059738814 9:117129263-117129285 TGAGGAACGGAGGGAGGAAGTGG - Intronic
1060000482 9:119953805-119953827 TCAGGAGGGGTGGAAAGAAGTGG - Intergenic
1060205861 9:121682516-121682538 TGAGGAGGGGTGGCATGTGATGG - Intronic
1060480901 9:124016230-124016252 TGGGGTGGGGTGGGGTGAGGTGG + Intronic
1060501109 9:124156569-124156591 GGAGGAGGAGGGGGAGGAAGTGG - Intergenic
1060972874 9:127748835-127748857 TGAGGAGGGGTGGCATCAGGTGG + Intronic
1061371648 9:130200855-130200877 TGGGGAGGGGAGGGCTGGAGGGG + Intronic
1061670544 9:132185829-132185851 GGAGGAGGAGTGGGAGGAGGAGG + Intronic
1061670550 9:132185847-132185869 GGAGGAGGAGTGGGAGGAGGAGG + Intronic
1061670556 9:132185865-132185887 GGAGGAGGAGTGGGAGGAGGAGG + Intronic
1061671897 9:132193492-132193514 TGAGGTGGGAGGGGACGAAGTGG + Intronic
1061783223 9:133007961-133007983 AGAGGAGGGGAGGGAAGAGGTGG - Intergenic
1061912074 9:133730248-133730270 GGAGGAGGGGTTGGTTGGAGTGG - Intronic
1061921486 9:133784874-133784896 TGGGGTGGGGTGGGGTGACGCGG + Intronic
1062343128 9:136102531-136102553 TGAGGAGGGCTGGGAGGGAAGGG + Intergenic
1062380287 9:136283816-136283838 TGAGAAGGGGTGGGAGGCAGAGG - Intronic
1062449149 9:136608283-136608305 AGAGGAAGGGAGGGAGGAAGGGG + Intergenic
1062675897 9:137743703-137743725 TGAGGAGGGCAGGGAGGACGGGG - Intronic
1062697945 9:137884952-137884974 GGAGGAGGGGGGGGGGGAAGAGG - Intronic
1062744614 9:138203444-138203466 AGAGGAGGAGGGGGATGAGGAGG + Intergenic
1203385418 Un_KI270438v1:46439-46461 TGGGGTGGATTGGGATGAAGTGG + Intergenic
1203385454 Un_KI270438v1:46655-46677 TGAAGAGGAGTGGAATGGAGTGG + Intergenic
1203582797 Un_KI270746v1:27905-27927 TGTGGTGGGGTGGGAGGAGGGGG + Intergenic
1185499086 X:584110-584132 AGAGGAGGAGAGGGAGGAAGAGG + Intergenic
1185499111 X:584210-584232 AGAGGAGGAGAGGGAGGAAGAGG + Intergenic
1185499139 X:584310-584332 AGAGGAGGAGAGGGAGGAAGAGG + Intergenic
1185511532 X:668023-668045 GGAGGAGGGGAGGGGGGAAGGGG - Intergenic
1185717790 X:2356671-2356693 TGAGGAGGAGAAGGAGGAAGAGG - Intronic
1185814497 X:3142408-3142430 GGAGGAGGTGGGGGAGGAAGAGG + Intergenic
1185870499 X:3660895-3660917 AGAGGAGGGGAAGGAAGAAGAGG + Intronic
1186297989 X:8169854-8169876 TGAGGGAGGGAGGGAGGAAGAGG - Intergenic
1186311339 X:8322973-8322995 TGAGGAGGAGGAGGAAGAAGAGG + Intergenic
1186505698 X:10090155-10090177 GGAGGAAAGGTGGGAGGAAGGGG + Intronic
1186513214 X:10146773-10146795 TTTGGAGGGGGGGGATGCAGAGG - Intergenic
1186853331 X:13601818-13601840 TAGGGAGGGGTGGGAGGAGGAGG - Intronic
1187220290 X:17319284-17319306 TGCGGTGGGGTGGGGGGAAGGGG - Intergenic
1187452913 X:19414181-19414203 AGAGGAGGGGTGAGATGAGGAGG + Intronic
1187487982 X:19722500-19722522 TGAGTAGGGCTGGGAGCAAGGGG - Intronic
1187722347 X:22164223-22164245 TGGGGTGGGGTAGGATGAGGAGG + Intronic
1187960939 X:24565382-24565404 GGAGGAAGGGGGGGAAGAAGAGG + Intronic
1188017701 X:25123208-25123230 TGAGGAAGGGAGGGAAGAACTGG - Intergenic
1188857296 X:35211889-35211911 TGGGGATGGGGGGGATGGAGAGG - Intergenic
1189005319 X:36987926-36987948 TGAGGTGTGGAGGAATGAAGTGG - Intergenic
1189043708 X:37570016-37570038 TGAGGTGTGGAGGAATGAAGTGG + Intronic
1189052854 X:37664709-37664731 TGAGGAGGGAGGGTAGGAAGAGG - Intronic
1189333239 X:40155484-40155506 GAAGGAGGAGTGGGAGGAAGTGG + Intronic
1189412847 X:40789363-40789385 TGAGGAGGTGAGGGAGGCAGTGG + Intergenic
1189425238 X:40894791-40894813 TGAAGAGGAGAGGGAGGAAGAGG + Intergenic
1189558571 X:42169818-42169840 TGAGGAGGAGGAGGAAGAAGAGG + Intergenic
1189656275 X:43248187-43248209 TGAGGAGGGGGGGATTGAGGAGG + Intergenic
1190091218 X:47439067-47439089 TGTGGAGGAGTCAGATGAAGAGG - Intergenic
1190107124 X:47568910-47568932 TGGGGAGGGGTGGGGGGAAAGGG + Intronic
1190108021 X:47573014-47573036 GGTGGAGGCGTGGGAGGAAGGGG + Intronic
1190232646 X:48594292-48594314 AGCAGAGTGGTGGGATGAAGGGG + Intronic
1190285767 X:48960412-48960434 TGAGGAGAGGAAGGATGGAGAGG - Intergenic
1190451034 X:50580977-50580999 TGAGGATGGGTAGGATCAAAGGG + Intergenic
1190727207 X:53197436-53197458 GGAGGAGGAGTGAGATGGAGAGG - Intronic
1191538326 X:62107223-62107245 TGAGGAAGAGTGGGAGGAGGAGG + Intergenic
1191842735 X:65524741-65524763 TGGGGTGGGGTGGGATGGGGTGG - Intronic
1191862603 X:65678174-65678196 TGAGGTGGGGTGGCAAGGAGAGG - Intronic
1191883651 X:65866643-65866665 GGAGGAGATGTGTGATGAAGAGG - Intergenic
1192178217 X:68899049-68899071 TGAGGAGGGGAGTGGAGAAGTGG + Intergenic
1192202337 X:69074468-69074490 TGAGCAAGGGTGGGAGGTAGGGG - Intergenic
1192248497 X:69392064-69392086 TGAGGAGGGGAGGGAGGTAGTGG + Intergenic
1192503001 X:71665502-71665524 AGAGGAGGAGGAGGATGAAGAGG + Intergenic
1192906295 X:75555304-75555326 TGTGGTGGGGTGGGGGGAAGGGG - Intergenic
1192974945 X:76273265-76273287 TGTGGTGGGGTGGGGTGAGGGGG + Intergenic
1193379957 X:80808037-80808059 GGGGGAGGCGTGGGAGGAAGGGG - Intronic
1193919937 X:87412896-87412918 TGTTGTGGGGTGGGAGGAAGGGG - Intergenic
1194318459 X:92411914-92411936 GGAGGAGGAGTGGGAGGAGGAGG + Intronic
1194318471 X:92411942-92411964 GGAGGAGGAGTGGGAGGAGGAGG + Intronic
1194318491 X:92412028-92412050 TGAGGAGGAGGAGGAGGAAGAGG + Intronic
1194670489 X:96726526-96726548 AGAGGTGAGGTGGGATGGAGCGG + Intronic
1194969463 X:100326939-100326961 AGAGGAGTGGTGGGGGGAAGAGG - Intronic
1195116853 X:101707715-101707737 TGAGGAGGAGCAGGAAGAAGAGG + Intergenic
1195272147 X:103242579-103242601 TGAGGAGTATTGAGATGAAGGGG - Intergenic
1195275247 X:103275177-103275199 GGAGGAGGGGTGGCAGGCAGTGG + Intronic
1195577527 X:106468019-106468041 GGAGGAGGGCTGTGAAGAAGAGG - Intergenic
1195631419 X:107059336-107059358 TGGGGTGGGGTGGGCGGAAGGGG + Intergenic
1195668254 X:107449583-107449605 CGAGGAGGGGAGGGGAGAAGGGG - Intergenic
1196119244 X:112030800-112030822 AGAGGTGGAGTGGGATGGAGAGG + Intronic
1196814924 X:119657417-119657439 TGAGGATGGGAGAGATGATGAGG - Intronic
1197760604 X:130025246-130025268 TGAGGAGGAGGAGGAAGAAGAGG + Exonic
1198073316 X:133170655-133170677 GGAGGATGGGAAGGATGAAGAGG + Intergenic
1198101078 X:133422314-133422336 TGAGGCCTTGTGGGATGAAGGGG + Intergenic
1198165414 X:134050478-134050500 TGGGGGGCGGTGGGAGGAAGGGG - Intergenic
1198323230 X:135540737-135540759 GGAGGAGGAGGGGGAGGAAGAGG - Intronic
1198770010 X:140120464-140120486 TGAGTAGTGTTGGGAGGAAGTGG - Intergenic
1198818386 X:140617831-140617853 TGTTGTGGGGTGGGGTGAAGGGG - Intergenic
1199669518 X:150131554-150131576 TGTGGAGGGGTGGGGGGAGGGGG - Intergenic
1199794331 X:151180168-151180190 TGAGGAGAGGGAGGACGAAGTGG - Exonic
1199855527 X:151756137-151756159 GGAGGAGGGGCAGGAGGAAGAGG - Intergenic
1200626628 Y:5525204-5525226 GGAGGAGGAGTGGGAGGAGGAGG + Intronic
1200626633 Y:5525219-5525241 GGAGGAGGAGTGGGAGGAGGAGG + Intronic
1200793545 Y:7320248-7320270 AGAGGAGGGGAAGGAAGAAGAGG - Intergenic
1201107647 Y:10775190-10775212 TGGGGAGGAGTGGAATGAAATGG - Intergenic
1201112788 Y:10812631-10812653 TGGAGTGGGGTGGAATGAAGTGG - Intergenic
1201113377 Y:10817433-10817455 TGGAGTGGAGTGGGATGAAGTGG - Intergenic
1201127901 Y:10930875-10930897 TGGAAAGGGGTGGAATGAAGTGG - Intergenic
1201132304 Y:10961596-10961618 TGGGGAGGAGTGGAATGGAGTGG - Intergenic
1201146498 Y:11067771-11067793 AGAGGAGGGGAGGGAGGGAGAGG + Intergenic
1201540935 Y:15103811-15103833 TGAGTAGGGGTGGGATCACAGGG + Intergenic
1201549997 Y:15209431-15209453 AGAGGAGGGGAGGGAAGGAGGGG + Intergenic
1202045558 Y:20734403-20734425 AGAGGAGGGGAGGGGAGAAGAGG + Intergenic