ID: 1051073149

View in Genome Browser
Species Human (GRCh38)
Location 9:13197758-13197780
Sequence CTCAAACTCTTCCAAGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051073140_1051073149 9 Left 1051073140 9:13197726-13197748 CCAGTAACCAATACCTCTTCATC 0: 1
1: 1
2: 6
3: 52
4: 467
Right 1051073149 9:13197758-13197780 CTCAAACTCTTCCAAGCCTCTGG No data
1051073139_1051073149 10 Left 1051073139 9:13197725-13197747 CCCAGTAACCAATACCTCTTCAT 0: 1
1: 0
2: 7
3: 69
4: 602
Right 1051073149 9:13197758-13197780 CTCAAACTCTTCCAAGCCTCTGG No data
1051073141_1051073149 2 Left 1051073141 9:13197733-13197755 CCAATACCTCTTCATCCCACCCC 0: 1
1: 0
2: 4
3: 46
4: 742
Right 1051073149 9:13197758-13197780 CTCAAACTCTTCCAAGCCTCTGG No data
1051073142_1051073149 -4 Left 1051073142 9:13197739-13197761 CCTCTTCATCCCACCCCTCCTCA 0: 1
1: 1
2: 8
3: 108
4: 1227
Right 1051073149 9:13197758-13197780 CTCAAACTCTTCCAAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051073149 Original CRISPR CTCAAACTCTTCCAAGCCTC TGG Intronic
No off target data available for this crispr