ID: 1051073939

View in Genome Browser
Species Human (GRCh38)
Location 9:13207492-13207514
Sequence TTACCTCAGCCTGGACTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051073935_1051073939 0 Left 1051073935 9:13207469-13207491 CCATGGAGTCTCCGCAAGTCCTG 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1051073939 9:13207492-13207514 TTACCTCAGCCTGGACTCTCTGG No data
1051073933_1051073939 26 Left 1051073933 9:13207443-13207465 CCTCTGACTTGCAGTTCTCTCTT 0: 1
1: 0
2: 4
3: 30
4: 417
Right 1051073939 9:13207492-13207514 TTACCTCAGCCTGGACTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051073939 Original CRISPR TTACCTCAGCCTGGACTCTC TGG Intronic
No off target data available for this crispr