ID: 1051075430

View in Genome Browser
Species Human (GRCh38)
Location 9:13228233-13228255
Sequence TGAACATTTCAGTCTAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051075425_1051075430 12 Left 1051075425 9:13228198-13228220 CCAAATAATTATCTGTTTTCTGT 0: 1
1: 0
2: 3
3: 56
4: 712
Right 1051075430 9:13228233-13228255 TGAACATTTCAGTCTAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051075430 Original CRISPR TGAACATTTCAGTCTAAAGG GGG Intronic
No off target data available for this crispr