ID: 1051078121

View in Genome Browser
Species Human (GRCh38)
Location 9:13264800-13264822
Sequence CTGTTAACTCACACCAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051078116_1051078121 -10 Left 1051078116 9:13264787-13264809 CCCTCCCCTCAAACTGTTAACTC 0: 1
1: 0
2: 1
3: 26
4: 202
Right 1051078121 9:13264800-13264822 CTGTTAACTCACACCAAACATGG No data
1051078112_1051078121 18 Left 1051078112 9:13264759-13264781 CCTTAATGTATCTCTATTGGACA 0: 1
1: 0
2: 0
3: 5
4: 128
Right 1051078121 9:13264800-13264822 CTGTTAACTCACACCAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051078121 Original CRISPR CTGTTAACTCACACCAAACA TGG Intronic
No off target data available for this crispr