ID: 1051095538

View in Genome Browser
Species Human (GRCh38)
Location 9:13461500-13461522
Sequence TTTTTTATGCTGAAAGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051095534_1051095538 30 Left 1051095534 9:13461447-13461469 CCTGAAGTACCCAGGATATACTG No data
Right 1051095538 9:13461500-13461522 TTTTTTATGCTGAAAGTGTTAGG No data
1051095535_1051095538 21 Left 1051095535 9:13461456-13461478 CCCAGGATATACTGTAAGTTCTG No data
Right 1051095538 9:13461500-13461522 TTTTTTATGCTGAAAGTGTTAGG No data
1051095536_1051095538 20 Left 1051095536 9:13461457-13461479 CCAGGATATACTGTAAGTTCTGG No data
Right 1051095538 9:13461500-13461522 TTTTTTATGCTGAAAGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051095538 Original CRISPR TTTTTTATGCTGAAAGTGTT AGG Intergenic
No off target data available for this crispr