ID: 1051097463

View in Genome Browser
Species Human (GRCh38)
Location 9:13483209-13483231
Sequence CATGGAAAAGAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051097463_1051097468 0 Left 1051097463 9:13483209-13483231 CCTTCCTCCTCCTCTTTTCCATG No data
Right 1051097468 9:13483232-13483254 TACTTTTCCTCCTCCTCCTCAGG No data
1051097463_1051097474 25 Left 1051097463 9:13483209-13483231 CCTTCCTCCTCCTCTTTTCCATG No data
Right 1051097474 9:13483257-13483279 TATCTTGTAGCAAACCTTCCAGG No data
1051097463_1051097469 1 Left 1051097463 9:13483209-13483231 CCTTCCTCCTCCTCTTTTCCATG No data
Right 1051097469 9:13483233-13483255 ACTTTTCCTCCTCCTCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051097463 Original CRISPR CATGGAAAAGAGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr