ID: 1051103812

View in Genome Browser
Species Human (GRCh38)
Location 9:13553899-13553921
Sequence TTTTATTGTAAACATACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051103812_1051103814 25 Left 1051103812 9:13553899-13553921 CCCTGGGTATGTTTACAATAAAA No data
Right 1051103814 9:13553947-13553969 TTTGACATCCATTCATGTCGTGG No data
1051103812_1051103815 26 Left 1051103812 9:13553899-13553921 CCCTGGGTATGTTTACAATAAAA No data
Right 1051103815 9:13553948-13553970 TTGACATCCATTCATGTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051103812 Original CRISPR TTTTATTGTAAACATACCCA GGG (reversed) Intergenic
No off target data available for this crispr