ID: 1051103813

View in Genome Browser
Species Human (GRCh38)
Location 9:13553900-13553922
Sequence TTTTTATTGTAAACATACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051103813_1051103814 24 Left 1051103813 9:13553900-13553922 CCTGGGTATGTTTACAATAAAAA No data
Right 1051103814 9:13553947-13553969 TTTGACATCCATTCATGTCGTGG No data
1051103813_1051103815 25 Left 1051103813 9:13553900-13553922 CCTGGGTATGTTTACAATAAAAA No data
Right 1051103815 9:13553948-13553970 TTGACATCCATTCATGTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051103813 Original CRISPR TTTTTATTGTAAACATACCC AGG (reversed) Intergenic
No off target data available for this crispr