ID: 1051103814

View in Genome Browser
Species Human (GRCh38)
Location 9:13553947-13553969
Sequence TTTGACATCCATTCATGTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051103812_1051103814 25 Left 1051103812 9:13553899-13553921 CCCTGGGTATGTTTACAATAAAA No data
Right 1051103814 9:13553947-13553969 TTTGACATCCATTCATGTCGTGG No data
1051103813_1051103814 24 Left 1051103813 9:13553900-13553922 CCTGGGTATGTTTACAATAAAAA No data
Right 1051103814 9:13553947-13553969 TTTGACATCCATTCATGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051103814 Original CRISPR TTTGACATCCATTCATGTCG TGG Intergenic
No off target data available for this crispr