ID: 1051107779

View in Genome Browser
Species Human (GRCh38)
Location 9:13599755-13599777
Sequence CTGGTTGTTACAGGGGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051107779_1051107785 -10 Left 1051107779 9:13599755-13599777 CCCTCAACCCCTGTAACAACCAG No data
Right 1051107785 9:13599768-13599790 TAACAACCAGTGGATTGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051107779 Original CRISPR CTGGTTGTTACAGGGGTTGA GGG (reversed) Intergenic
No off target data available for this crispr