ID: 1051107785

View in Genome Browser
Species Human (GRCh38)
Location 9:13599768-13599790
Sequence TAACAACCAGTGGATTGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051107777_1051107785 -2 Left 1051107777 9:13599747-13599769 CCTCCTTTCCCTCAACCCCTGTA No data
Right 1051107785 9:13599768-13599790 TAACAACCAGTGGATTGATTAGG No data
1051107779_1051107785 -10 Left 1051107779 9:13599755-13599777 CCCTCAACCCCTGTAACAACCAG No data
Right 1051107785 9:13599768-13599790 TAACAACCAGTGGATTGATTAGG No data
1051107778_1051107785 -5 Left 1051107778 9:13599750-13599772 CCTTTCCCTCAACCCCTGTAACA No data
Right 1051107785 9:13599768-13599790 TAACAACCAGTGGATTGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051107785 Original CRISPR TAACAACCAGTGGATTGATT AGG Intergenic
No off target data available for this crispr