ID: 1051108118

View in Genome Browser
Species Human (GRCh38)
Location 9:13603833-13603855
Sequence TCTTAGGCCCCGCAGCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051108118_1051108123 14 Left 1051108118 9:13603833-13603855 CCTTGGTGCTGCGGGGCCTAAGA No data
Right 1051108123 9:13603870-13603892 TTGGAGGTGGAGCTCTAAAATGG No data
1051108118_1051108120 -5 Left 1051108118 9:13603833-13603855 CCTTGGTGCTGCGGGGCCTAAGA No data
Right 1051108120 9:13603851-13603873 TAAGACAGCATGCAATCTGTTGG No data
1051108118_1051108121 -2 Left 1051108118 9:13603833-13603855 CCTTGGTGCTGCGGGGCCTAAGA No data
Right 1051108121 9:13603854-13603876 GACAGCATGCAATCTGTTGGAGG No data
1051108118_1051108122 1 Left 1051108118 9:13603833-13603855 CCTTGGTGCTGCGGGGCCTAAGA No data
Right 1051108122 9:13603857-13603879 AGCATGCAATCTGTTGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051108118 Original CRISPR TCTTAGGCCCCGCAGCACCA AGG (reversed) Intergenic
No off target data available for this crispr