ID: 1051108178 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:13604208-13604230 |
| Sequence | GATCATCCAAGAAAGAATAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1051108178_1051108180 | 27 | Left | 1051108178 | 9:13604208-13604230 | CCAGTATTCTTTCTTGGATGATC | No data | ||
| Right | 1051108180 | 9:13604258-13604280 | ATTTTGGTTCTTAGTGAAGAAGG | No data | ||||
| 1051108178_1051108179 | 11 | Left | 1051108178 | 9:13604208-13604230 | CCAGTATTCTTTCTTGGATGATC | No data | ||
| Right | 1051108179 | 9:13604242-13604264 | TGATTATCTACTCACTATTTTGG | 0: 24 1: 35 2: 69 3: 108 4: 288 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1051108178 | Original CRISPR | GATCATCCAAGAAAGAATAC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||