ID: 1051108178

View in Genome Browser
Species Human (GRCh38)
Location 9:13604208-13604230
Sequence GATCATCCAAGAAAGAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051108178_1051108180 27 Left 1051108178 9:13604208-13604230 CCAGTATTCTTTCTTGGATGATC No data
Right 1051108180 9:13604258-13604280 ATTTTGGTTCTTAGTGAAGAAGG No data
1051108178_1051108179 11 Left 1051108178 9:13604208-13604230 CCAGTATTCTTTCTTGGATGATC No data
Right 1051108179 9:13604242-13604264 TGATTATCTACTCACTATTTTGG 0: 24
1: 35
2: 69
3: 108
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051108178 Original CRISPR GATCATCCAAGAAAGAATAC TGG (reversed) Intergenic
No off target data available for this crispr