ID: 1051108180

View in Genome Browser
Species Human (GRCh38)
Location 9:13604258-13604280
Sequence ATTTTGGTTCTTAGTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051108178_1051108180 27 Left 1051108178 9:13604208-13604230 CCAGTATTCTTTCTTGGATGATC No data
Right 1051108180 9:13604258-13604280 ATTTTGGTTCTTAGTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051108180 Original CRISPR ATTTTGGTTCTTAGTGAAGA AGG Intergenic
No off target data available for this crispr