ID: 1051111537

View in Genome Browser
Species Human (GRCh38)
Location 9:13643484-13643506
Sequence ATCCAGTCTTGGTCAAACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051111537_1051111541 -6 Left 1051111537 9:13643484-13643506 CCACTGTTTGACCAAGACTGGAT No data
Right 1051111541 9:13643501-13643523 CTGGATCTGTTCTTAGTTTGGGG No data
1051111537_1051111539 -8 Left 1051111537 9:13643484-13643506 CCACTGTTTGACCAAGACTGGAT No data
Right 1051111539 9:13643499-13643521 GACTGGATCTGTTCTTAGTTTGG No data
1051111537_1051111542 6 Left 1051111537 9:13643484-13643506 CCACTGTTTGACCAAGACTGGAT No data
Right 1051111542 9:13643513-13643535 TTAGTTTGGGGTCTGCTGCATGG No data
1051111537_1051111540 -7 Left 1051111537 9:13643484-13643506 CCACTGTTTGACCAAGACTGGAT No data
Right 1051111540 9:13643500-13643522 ACTGGATCTGTTCTTAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051111537 Original CRISPR ATCCAGTCTTGGTCAAACAG TGG (reversed) Intergenic
No off target data available for this crispr