ID: 1051111538

View in Genome Browser
Species Human (GRCh38)
Location 9:13643495-13643517
Sequence ACTAAGAACAGATCCAGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051111538_1051111543 20 Left 1051111538 9:13643495-13643517 CCAAGACTGGATCTGTTCTTAGT No data
Right 1051111543 9:13643538-13643560 GTGCTTAGCTTTGCTAATTTTGG No data
1051111538_1051111542 -5 Left 1051111538 9:13643495-13643517 CCAAGACTGGATCTGTTCTTAGT No data
Right 1051111542 9:13643513-13643535 TTAGTTTGGGGTCTGCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051111538 Original CRISPR ACTAAGAACAGATCCAGTCT TGG (reversed) Intergenic
No off target data available for this crispr