ID: 1051111540

View in Genome Browser
Species Human (GRCh38)
Location 9:13643500-13643522
Sequence ACTGGATCTGTTCTTAGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051111532_1051111540 26 Left 1051111532 9:13643451-13643473 CCATAGGCCCTAATTATTAGTCC No data
Right 1051111540 9:13643500-13643522 ACTGGATCTGTTCTTAGTTTGGG No data
1051111531_1051111540 27 Left 1051111531 9:13643450-13643472 CCCATAGGCCCTAATTATTAGTC No data
Right 1051111540 9:13643500-13643522 ACTGGATCTGTTCTTAGTTTGGG No data
1051111534_1051111540 18 Left 1051111534 9:13643459-13643481 CCTAATTATTAGTCCTGTTATTT No data
Right 1051111540 9:13643500-13643522 ACTGGATCTGTTCTTAGTTTGGG No data
1051111537_1051111540 -7 Left 1051111537 9:13643484-13643506 CCACTGTTTGACCAAGACTGGAT No data
Right 1051111540 9:13643500-13643522 ACTGGATCTGTTCTTAGTTTGGG No data
1051111535_1051111540 5 Left 1051111535 9:13643472-13643494 CCTGTTATTTCTCCACTGTTTGA No data
Right 1051111540 9:13643500-13643522 ACTGGATCTGTTCTTAGTTTGGG No data
1051111533_1051111540 19 Left 1051111533 9:13643458-13643480 CCCTAATTATTAGTCCTGTTATT No data
Right 1051111540 9:13643500-13643522 ACTGGATCTGTTCTTAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051111540 Original CRISPR ACTGGATCTGTTCTTAGTTT GGG Intergenic
No off target data available for this crispr