ID: 1051111542

View in Genome Browser
Species Human (GRCh38)
Location 9:13643513-13643535
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051111537_1051111542 6 Left 1051111537 9:13643484-13643506 CCACTGTTTGACCAAGACTGGAT No data
Right 1051111542 9:13643513-13643535 TTAGTTTGGGGTCTGCTGCATGG No data
1051111538_1051111542 -5 Left 1051111538 9:13643495-13643517 CCAAGACTGGATCTGTTCTTAGT No data
Right 1051111542 9:13643513-13643535 TTAGTTTGGGGTCTGCTGCATGG No data
1051111535_1051111542 18 Left 1051111535 9:13643472-13643494 CCTGTTATTTCTCCACTGTTTGA No data
Right 1051111542 9:13643513-13643535 TTAGTTTGGGGTCTGCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051111542 Original CRISPR TTAGTTTGGGGTCTGCTGCA TGG Intergenic