ID: 1051111543

View in Genome Browser
Species Human (GRCh38)
Location 9:13643538-13643560
Sequence GTGCTTAGCTTTGCTAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051111538_1051111543 20 Left 1051111538 9:13643495-13643517 CCAAGACTGGATCTGTTCTTAGT No data
Right 1051111543 9:13643538-13643560 GTGCTTAGCTTTGCTAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051111543 Original CRISPR GTGCTTAGCTTTGCTAATTT TGG Intergenic
No off target data available for this crispr