ID: 1051116767

View in Genome Browser
Species Human (GRCh38)
Location 9:13704112-13704134
Sequence TTCAGTTACCACTTTAGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051116767_1051116769 -10 Left 1051116767 9:13704112-13704134 CCCTTGCTAAAGTGGTAACTGAA No data
Right 1051116769 9:13704125-13704147 GGTAACTGAAACATGCAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051116767 Original CRISPR TTCAGTTACCACTTTAGCAA GGG (reversed) Intergenic
No off target data available for this crispr