ID: 1051119509

View in Genome Browser
Species Human (GRCh38)
Location 9:13736716-13736738
Sequence GTGTCCTTCTAGAGCACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051119506_1051119509 25 Left 1051119506 9:13736668-13736690 CCTATTCTTGAGGTCTGCATCTC No data
Right 1051119509 9:13736716-13736738 GTGTCCTTCTAGAGCACTGAAGG No data
1051119505_1051119509 30 Left 1051119505 9:13736663-13736685 CCATGCCTATTCTTGAGGTCTGC No data
Right 1051119509 9:13736716-13736738 GTGTCCTTCTAGAGCACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051119509 Original CRISPR GTGTCCTTCTAGAGCACTGA AGG Intergenic
No off target data available for this crispr