ID: 1051123474

View in Genome Browser
Species Human (GRCh38)
Location 9:13777353-13777375
Sequence TTGGGGGCCCACAAGTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051123474_1051123482 23 Left 1051123474 9:13777353-13777375 CCCTCATACTTGTGGGCCCCCAA No data
Right 1051123482 9:13777399-13777421 GAGAAAGAGCTCCCATACTTTGG No data
1051123474_1051123476 -9 Left 1051123474 9:13777353-13777375 CCCTCATACTTGTGGGCCCCCAA No data
Right 1051123476 9:13777367-13777389 GGCCCCCAACAAACAGTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051123474 Original CRISPR TTGGGGGCCCACAAGTATGA GGG (reversed) Intergenic
No off target data available for this crispr