ID: 1051131181

View in Genome Browser
Species Human (GRCh38)
Location 9:13862706-13862728
Sequence TGTCCAGCCCCATTTATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051131181_1051131184 -3 Left 1051131181 9:13862706-13862728 CCTGAAATAAATGGGGCTGGACA No data
Right 1051131184 9:13862726-13862748 ACAGGCACATTGGTCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051131181 Original CRISPR TGTCCAGCCCCATTTATTTC AGG (reversed) Intergenic
No off target data available for this crispr