ID: 1051131184

View in Genome Browser
Species Human (GRCh38)
Location 9:13862726-13862748
Sequence ACAGGCACATTGGTCTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051131181_1051131184 -3 Left 1051131181 9:13862706-13862728 CCTGAAATAAATGGGGCTGGACA No data
Right 1051131184 9:13862726-13862748 ACAGGCACATTGGTCTTTTCTGG No data
1051131175_1051131184 11 Left 1051131175 9:13862692-13862714 CCTTTGGGTGCCTGCCTGAAATA No data
Right 1051131184 9:13862726-13862748 ACAGGCACATTGGTCTTTTCTGG No data
1051131179_1051131184 1 Left 1051131179 9:13862702-13862724 CCTGCCTGAAATAAATGGGGCTG No data
Right 1051131184 9:13862726-13862748 ACAGGCACATTGGTCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051131184 Original CRISPR ACAGGCACATTGGTCTTTTC TGG Intergenic
No off target data available for this crispr