ID: 1051135280 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:13913133-13913155 |
| Sequence | TGGTCTAGGTCACAGGACAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1051135280_1051135286 | 25 | Left | 1051135280 | 9:13913133-13913155 | CCACTGTCCTGTGACCTAGACCA | No data | ||
| Right | 1051135286 | 9:13913181-13913203 | CGCCAGATGATAAATATCTGGGG | No data | ||||
| 1051135280_1051135284 | 23 | Left | 1051135280 | 9:13913133-13913155 | CCACTGTCCTGTGACCTAGACCA | No data | ||
| Right | 1051135284 | 9:13913179-13913201 | AGCGCCAGATGATAAATATCTGG | No data | ||||
| 1051135280_1051135285 | 24 | Left | 1051135280 | 9:13913133-13913155 | CCACTGTCCTGTGACCTAGACCA | No data | ||
| Right | 1051135285 | 9:13913180-13913202 | GCGCCAGATGATAAATATCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1051135280 | Original CRISPR | TGGTCTAGGTCACAGGACAG TGG (reversed) | Intergenic | ||