ID: 1051135280

View in Genome Browser
Species Human (GRCh38)
Location 9:13913133-13913155
Sequence TGGTCTAGGTCACAGGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051135280_1051135286 25 Left 1051135280 9:13913133-13913155 CCACTGTCCTGTGACCTAGACCA No data
Right 1051135286 9:13913181-13913203 CGCCAGATGATAAATATCTGGGG No data
1051135280_1051135284 23 Left 1051135280 9:13913133-13913155 CCACTGTCCTGTGACCTAGACCA No data
Right 1051135284 9:13913179-13913201 AGCGCCAGATGATAAATATCTGG No data
1051135280_1051135285 24 Left 1051135280 9:13913133-13913155 CCACTGTCCTGTGACCTAGACCA No data
Right 1051135285 9:13913180-13913202 GCGCCAGATGATAAATATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051135280 Original CRISPR TGGTCTAGGTCACAGGACAG TGG (reversed) Intergenic